Res. Plant Dis > Volume 23(3); 2017 > Article
경북 영양지역 노지고추의 바이러스병 발생양상


Incidence of virus diseases in red pepper of open field in Yeongyang-Gun, Gyeongbuk Province was investigated by reverse transcription-polymerase chain reaction in 2012-2016. The infection rate of Cucumber mosaic virus (CMV), Broad bean wilt virus 2 (BBWV2), Pepper mottle virus, Potato virus Y, Pepper mild mottle virus and Tomato spotted wilt virus was 46.1%, 41.5%, 2.0%, 2.0%, 4.4% and 0.1% respectively. Incidence rate of single and mixed infection was 31.2% and 62.6%. Most of single infections were CMV and BBWV2. Among mixed infections, the incidence rate of CMV+BBWV2 mixed infection was the highest as 49.3% and most of mixed infections of triplex and tetraplex included CMV+BBWV2 mixed infection. CMV single infection caused mosaic, chlorosis, yellowing and vein necrosis and BBWV2 single infection induced cholosis and mosaic. CMV+BBWV2 mixed infection caused severe mosaic with chlorosis or malformation.


고추(Capsicum annuum L.)는 열대아메리카가 원산지이며, 우리나라에는 약 400년 전에 도입되어 중요 양념채소로 여겨지고 있다. 또한, 주곡인 벼를 제외하고 재배면적이나 생산액에서도 가장 중요한 작물 중 하나이다. 노지고추는 경북, 충북, 전북을 중심으로 2015년에 채소 재배면적의 17.5%인 34,514 ha에서 97,697톤이 생산되었으며, 그 중에서 경북 영양지역의 노지 고추 재배면적은 약 1,190 ha로 안동지역과 함께 국내 최대 주 산지로 꼽히고 있다(Korean Statistical Information Service). 하지만, 매년 고추에서 발생하는 탄저병, 역병, 풋마름병 같은 주요 병들은 생산량 감소와 상품성을 떨어뜨려 경제적 손실이 발생하고 있다. 또한, 최근에는 위축, 괴저, 기형과 등을 유발하는 바이러스병 발생이 고추에서 지속적으로 증가하여 재배농가에 피해를 주고 있다.
세계적으로 고추에서 발생하는 바이러스는 66여종에 이르지만, 지역에 따라 몇 종의 바이러스만 경제적으로 큰 피해를 준다(Abdalla 등, 1991; Benner 등, 1985; Cho 등, 2007). 국내에는 16종의 바이러스가 고추에 발생한다고 보고되어 있다(The Korean Society of Plant Pathology, 2009). 1971년과 1973년 조사에서 국내 고추에 발생하는 바이러스는 Alfalfa mosaic virus, Cucumber mosaic virus (CMV), Potato virus X (PVX), Potato virus Y (PVY), Tobacco mosaic virus (TMV)가 단독 또는 복합감염 되어 있다고 하였다(Kang 등, 1973; La 등, 1972). 80년대 후반 바이러스 발생조사에서는 Tobamovirus인 TMV가 고추 생육 기간 동안 약 90%가 발생하여 주요 바이러스로 나타났다(Kim 등, 1990). 하지만, 2000년 이후로는 종자의 건전화와 플러그 육묘 등 재배환경의 변화로 Tobamovirus 발생이 이전보다 현저히 낮아진 것으로 보고되었다(Cho 등, 2007; Lee 등, 2004). 반 면에 진딧물 전염성인 CMV와 Broad bean wilt virus 2 (BBWV2)의 감염률은 크게 증가한 것으로 조사되었다(Cho 등, 2007). 최근에는 BBWV2, CMV, Impatiens necrotic spot virus, Pepper mild mottle virus (PMMoV), Pepper mottle virus (PepMoV), PVY, Tobacco mild green mosaic vitus, Tomato spotted wilt virus (TSWV) 등 8종의 바이러스가 고추에서 발생하는 것으로 나타나(Kim 등, 2012), 바이러스 발생양상이 변화하고 있는 것을 알 수 있다. 또한, 고추 재배환경에 따라 바이러스 발생양상이 다르게 나타나는데, Lee 등(2004)은 노지재배에서는 CMV와 BBWV2, 하우스재배에서는 PMMoV의 발생비율이 높으며, 노지재배가 하우스재배 보다 복합감염이 활발히 일어난다고 하였다. 최근 고추에서 심각한 피해를 주고 있는 TSWV는 2003년 충남 예산지역 파프리카에서 발생된 후 서남해안 지역을 중심으로 피해가 발생하고 있어, 지역에 따라 발생의 차이가 있는 것 으로 나타났다(Lee 등, 2015; Kim 등, 2004; Ko 등, 2013). 이와 같이 국내 고추에서 발생하는 바이러스는 재배법 및 재배환경에 따라 변화하고 있고, 지역에 따라 바이러스 발생비율이 다르기 때문에 지속적인 조사가 중요하다.
이에 본 연구에서는 노지고추 최대 주산지인 경북 영양지역에서 2012년부터 2016년까지 노지고추 바이러스 발생양상을 조사하여, 바이러스병 피해를 줄이기 위한 기초 자료로 활용하고자 수행하였다.

재료 및 방법

바이러스 시료 수집

영양읍, 청기면, 일월면, 수비면을 중심으로 2012년부터 2014년까지는 30농가, 2015년과 2016년은 20농가를 임의 선정하여 7월 중순부터 8월 하순까지 실시하였다. 바이러스병 발생양상 조사를 위한 시료는 2012년 180점, 2013년 270점, 2104년 270점, 2015년 60점, 2016년 60점을 수집하였다.

진단 바이러스 종류

최근 국내 고추에 발생하여 피해를 주는 BBWV2, CMV, PMMoV, PepMoV, PVY, TSWV 등 6종에 대하여 종 특이적 primer (Table 1)를 이용하여 reverse transcription-polymerase chain reaction (RT-PCR) 방법으로 진단하였다.
Table 1
Overview of primer pairs used for detection of virus infection in red pepper
Virus Primer pairs    Primer sequence (5’→3’) Product size (bp) Reference
BBWV2 BBWV2 1-1u AAACAAACAGCTTTCGTTCCG 380 Kwak et al., 2013






Total RNA분리

TRIzol Reagent (Life technologies Co., USA)를 사용하여 메뉴얼에 따라 수집한 각 시료 0.1 g에서 total RNA를 분리하였다. 분리된 total RNA는 80% 에탄올에 세척 후 완전히 건조한 다음 RNase-free water 100 µl에 용해한 후 RT-PCR을 위한 주형 RNA로 사용하였다.


역전사 반응은 Accupower® RT Premix (Bioneer Co., Korea)를 이용하여 수행하였다. 추출한 total RNA 2 µl를 주형로 사용하고 random haxamer primer (Bioneer Co., Korea) 를 downstream primer로 하여 4 µl (5 pmol/µl)를 첨가한 후 멸균수로 전체 용량을 20 µl로 조정하였다. 역전사 반응조건은 42°C에서 1시간 항온처리 한 후 95°C에서 5분간 변성시켰다. PCR은 Accupower® PCR Premix (Bioneer Co., Korea)에 역전사반응액 1 µl, 정방향과 역방향 primer 각 1 µl (10 pmol/µl) 를 첨가한 후 멸균수로 전체 용량을 20 µl로 조정하여 수행하였다. PCR 반응조건은 95°C에서 10분간 denaturation 후, 95°C에서 30초, 57°C에서 40초, 72°C에서 45초로 35회 반복하였다. 반복 후에는 72°C에서 5분간 extension 반응을 행하였다. RT-PCR 산물은 2012년부터 2015년까지는 1× TAE buffer를 이용하여 1.2% agarose gel에서 전기영동 한 후 ethidium bromide로 염색하여 UV transilluminator로 확인하였고 2016년에는 QIAxcel Advanced (Qiagen, Germany)로 RT-PCR 산물을 확인하였다.

결과 및 고찰

영양지역 노지고추의 바이러스 발생비율

영양지역 노지 고추에서 발생하는 바이러스의 발생양상을 조사하기 위해서 최근 고추에서 발생하는 6종의 바이러스에 대하여 RT-PCR로 감염유무를 확인하였고(Fig. 1) 진단한 결과는 Table 2에서 보는 바와 같다. CMV의 발생률은 2012년에 24.9%였지만 2013년 47.8%, 2014년 46.1%, 2015년 59.1%, 2016년 52.7%로 급격히 증가하여 영양지역 노지고추에서 가장 많이 발생하는 바이러스로 조사되었다. BBWV2는 2012년도에 60.6%로 가장 많이 발생하였지만 2013년 이후에는 연도에 따라 발생률이 28.4-44.7%로 낮아지는 경향을 보였다. 하지만, BBWV2의 평균 발생률은 41.5%로 CMV와 더불어 영양지역 노지고추에서 우점하는 바이러스로 나타났다. PepMoV는 2012년에 8.0%, 2013년에 2.2%의 발생률을 보였지만 2014년 이후 수집시료에서는 발생이 없는 것으로 나타나 영양지역에서 PepMoV에 의한 피해는 제한적일 것으로 생각된다. 또한 Cho 등(2007)도 2002년과 2004년에 조사에서 PepMoV 발생비율이 22.2%와 31.4%로 높았지만 2005년 이후에는 발생이 급속히 감소하였다고 보고하여 노지 고추에서 PepMoV의 중요도는 낮아진 것으로 판단된다. PVY의 평균 발생률은 2.0%로 Lee 등(2004)이 전국 조사에서 보고 한 0.4% 보다 높은 경향을 나타내었다. 영양지역을 포함한 경북북부지역은 잎담배 주산지이고 잎담배에서 발생하는 주요 바이러스로 PVY가 보고되어 있어(Yi와 Yim, 2007), 노지고추와 잎담배에서 발생하는 PVY의 상관관계에 대한 추가적인 연구가 필요할 것으로 생각된다. PMMoV는 2012년에는 발생이 없었지만 2013년에는 12.6%의 발생률을 보였다. 하지만, 2014년 이후에는 조사연도에 따라 발생률이 2.7-4.5%로 감소하는 것으로 나타나 영양지역 노지고추에서 PMMoV에 의한 피해는 낮을 것으로 생각된다. 고추에 강한 병원성을 나타내는 TSWV는 2013년 조사에서만 0.2%의 발생률을 보였다. 하지만 경기, 충남, 전남, 전북지역에서는 TSWV가 매년 발생하고 있고 일부지역에서는 심각한 피해를 주고 있어(Cho 등, 2005; Kim 등, 2008, Ko 등, 2013; Lee 등, 2015), TSWV에 대한 지속적인 모니터링이 필요할 것으로 생각된다.
Fig. 1
Detection of (A) BBWV2, (B) CMV, (C) PepMoV (D) PMMoV (E) PVY and (F) TSWV by RT-PCR. M, 100bp ladder; 1-7, samples; P, positive control; N, negative control.
Table 2
Occurrence of viruses in red pepper of open fields in Yeongyang-gun, Gyeongbuk province in 2012-2016
 Virus Infection rate (%)

 2012   2013   2014   2015   2016  Average
CMV 24.9 47.8 46.1 59.1 52.7 46.1
BBWV2 60.6 29.9 44.1 28.4 44.7 41.5
PepMoV 8.0 2.2 0.0 0.0 0.0 2.0
PVY 3.6 0.9 5.3 0.0 0.0 2.0
PMMoV 0.0 12.6 2.7 4.5 2.6 4.4
TSWV 0.0 0.2 0.0 0.0 0.0 0.1
Unidentified 2.9 6.4 1.8 8.0 0.0 3.8

영양지역 노지고추의 바이러스 감염양상

영양지역 노지 고추에서 발생하는 6종의 바이러스에 대한 감염양상은 Table 3에서 보는 바와 같다. 5년간 단독감염과 복합감염의 평균 발생률을 보면 단독감염은 31.2%, 복합감염은 62.6%로 영양지역 노지고추에서는 복합감염에 의한 피해가 많은 것으로 나타났다. 또한 국내 노지고추에서 발생하는 바이러스의 감염형태도 단독감염이 감소하고 복합감염이 증가하고 있다고 보고되었다(Cho 등, 2007; Kim 등, 1990; Lee 등, 2004, 2015). 6종의 바이러스에 대한 단독감염 발생률을 보면 CMV는 2012년을 제 외하고 2013-2016년까지 단독감염률이 나머지 5종의 바이러스 보다 높았으며, 평균 발생률도 19.1%로 가장 많이 발생하였다. BBWV2는 2012년 단독감염률이 49.4%로 가장 높았지만 2013년 이후에는 급격히 감소하는 것으로 나타났다. PepMoV, PVY, PMMoV는 단독감염 평균 발생률이 0.4%, 0.2%, 0.1%로 나타나 이들 세 바이러스는 영양지역 노지고추에서 병원성이 낮은 것으로 생각된다. TSWV는 5년간 조사에서 단독감염 발생이 없는 것으로 나타나 영양지역에서 TSWV의 영향은 제한적일 것으로 판단된다. 복합감염 형태는 CMV와 BBWV2 복합감염이 가장 많은 것으로 나타났다. CMV와 BBWV2 복합감염은 2012년 27.2%였지만 2015년을 제외하고 지속적으로 증가하여 2016년에는 80.0%의 발생률을 보였으며, 평균 발생률도 49.3% 로 조사되어 CMV와 BBWV2 복합감염은 영양지역 노지고추에 피해를 발생시키는 중요한 감염형태인 것으로 생각된다. 또한 3종 및 4종 복합감염도 대부분 CMV와 BBWV2 복합감염에 PepMoV, PMMoV, PVY, TSWV가 결합하는 형태를 보였으며 이들 복합감염 평균 발생률은 9.0%로 나타났다. 이러한 결과로 영양지역 노지고추에서는 CMV와 BBWV2에 의한 피해가 가장 많을 것으로 판단된다.
Table 3
Incidence of viruses of single and mixed infection in red pepper of open fields in Yeongyang-gun, Gyeongbuk province in 2012-2016
 Virus Infection rate (%)

 2012   2013   2014   2015   2016  Average
Single infection 51.6 34.7 8.5 46.7 15.0 31.2
CMV 1.1 28.1 6.3 45.0 15.0 19.1
BBWV2 49.4 4.1 1.9 1.7 0.0 11.4
PepMoV 1.1 1.1 0.0 0.0 0.0 0.4
PVY 0.0 0.7 0.4 0.0 0.0 0.2
PMMoV 0.0 0.7 0.0 0.0 0.0 0.1
TSWV 0.0 0.0 0.0 0.0 0.0 0.0

Mixed infection 44.0 54.0 87.8 41.7 85.0 62.6
CMV+BBWV2 27.2 31.5 72.6 35.0 80.0 49.3
CMV+PVY 0.6 0.4 0.0 0.0 0.0 0.2
CMV+PepMoV 0.6 0.0 0.0 0.0 0.0 0.1
CMV+PMMoV 0.0 7.0 0.0 1.7 0.0 1.7
BBWV2+PepMoV 5.6 1.9 0.0 0.0 0.0 1.5
BBWV2+PVY 1.7 0.4 0.4 0.0 0.0 0.5
CMV+BBWV2+PVY 3.3 0.0 9.3 0.0 0.0 2.5
CMV+BBWV2+PMMoV 0.0 10.4 4.8 5.0 5.0 5.0
CMV+BBWV2+PepMoV 5.0 1.5 0.0 0.0 0.0 1.3
CMV+PMMoV+PepMoV 0.0 0.4 0.0 0.0 0.0 0.1
CMV+PMMoV+TSWV 0.0 0.4 0.0 0.0 0.0 0.1
CMV+BBWV2+PMMoV+PepMoV 0.0 0.7 0.0 0.0 0.0 0.1
CMV+BBWV2+PMMoV+PVY 0.0 0.0 0.7 0.0 0.0 0.1

Unidentified 4.4 10.7 3.7 11.6 0.0 6.1

영양지역 노지고추의 바이러스 병징

노지고추에서 발생하는 CMV는 대부분 모자이크 병징을 일으킨다고 하였는데(Cho 등, 2007), 영양지역 노지고추에 감염하는 CMV는 주로 모자이크(Fig. 2A)와 퇴록(Fig. 2B) 병징을 보였다. 또한 황화(Fig. 2C) 및 괴저(Fig. 2D) 병징도 발생하는 것으로 확인되었다. 이와 같은 병징의 차이가 영양지역에서만 나타나는 것인지에 대해서는 노지고추 주산지를 중심으로 추가적인 조사가 필요할 것으로 생각된다. BBWV2가 감염된 고추 잎에서는 주로 퇴록 병징을 나타냈으며(Fig. 3A, Fig. 3B), 모자이크 병징과 복합적으로 발생하기도 하였다(Fig. 3C, Fig. 3D). 영양지역 노지고추에 주요 감염형태인 CMV와 BBWV2의 복합감염 병징은 퇴록 병징과 심한 모자이 크 병징을 보였고(Fig. 4A, Fig. 4B), 병징이 더 진전된 경우에는 잎이 기형이 되는 병징을 나타내었다(Fig. 4C). 이는 CMV와 BBWV2 의 복합감염이 단독감염보다 병징을 강하게 상승시킨 결과에 따른 것으로 생각된다. CMV와 BBWV2를 포함하는 3종 복합 감염에서도 퇴록과 모자이크 병징을 나타내었다. 하지만 CMV, BBWV2, PepMoV와 CMV, BBWV2, PVY 3종 복합감염은 퇴록과 심한 모자이크 병징(Fig. 4D, Fig. 4E)을 보였지만 CMV, BBWV2와 PMMoV의 3종 복합감염은 비교적 모자이크 병징이 심하지 않아(Fig. 4F) 3종 복합감염에서도 바이러스 조합에 따라 병징의 강도에 차이가 있는 것으로 생각된다.
Fig. 2
Symptoms induced by CMV single infection. Mosaic (A), chlorosis (B), yellowing (C), vein necrosis (D).
Fig. 3
Symptoms induced by BBWV2 single infection. Chlorosis (A, B), mosaic with chlorosis (C, D).
Fig. 4
Symptoms induced by mixed infection. Severe mosaic with chlorosis by CMV and BBWV2 (A, B), sever mosaic with malformation by CMV and BBWV2 (C), severe mosaic with chlorosis by CMV, BBWV2 and PepMoV (D), severe mosaic with chlorosis by CMV, BBWV2 and PVY (E), Mosaic with chlorosis by CMV, BBWV2 and PMMoV (F).


경북 영양지역 노지고추 재배지에서 2012년부터 2016년까지 바이러스 증상를 보이는 시료를 채집하여 RT-PCR로 바이러스 감염양상을 조사하였다. 수집된 시료에 감염된 바이러스는 CMV 46.1%, BBWV2 41.5%, PepMoV 2.0%, PVY 2.0%, PMMoV 4.4%, TSWV 0.1%로 CMV와 BBWV2가 영양지역 노지고추에서 우점하는 바이러스로 나타났다. 바이러스 감염형태는 복합감염이 62.6%로 단독감염 31.2% 보다 많았다. 단독감염은 CMV가 19.1%로 가장 많았으며, BBWV2도 11.4%의 발생률을 보였다. 복합감염은 CMV+BBWV2 발생률이 49.3%로 가장 많았으며, 3종 및 4종 복합감염에서도 대부분 CMV+BBWV2를 포함하는 감염형태를 나타내었다. CMV 단독감염에서는 모자이크, 퇴록, 괴저, 황화 병징을 보였으며 BBWV2 단독감염은 퇴록, 모자이크 병징을 나타내었다. CMV와 BBWV2 복합감염은 퇴록과 심한 모자이크, 기형 병징을 일으켰다.


Conflicts of Interest

The authors declare that they have no competing and commercial interests in this work.


Abdalla, O. A, Desjardine, P. R and Dodds, J. A 1991. Identification, disease incidence, and distribution of viruses infecting peppers in California. Plant Dis. 75: 1019-1023.
Benner, C. P, Kuhn, C. W, Demski, J. W, Dobson, J. W, Colditz, P and Nutter, F. W Jr 1985. Identification and incidence of pepper viruses in Northeastern Georgia. Plant Dis. 69: 999-1001.
Cho, J. D, Kim, J. S, Kim, J. Y, Kim, J. H, Lee, S. H, Choi, G. S, Kim, H. R and Chung, B. N 2005 Occurrence and symptoms of Tomato spotted wilt virus on vegetables in Korea (1). Res. Plant Dis. 11: 213-216. (In Korean).
Cho, J. D, Kim, J. S, Lee, S. H, Choi, G. S and Chung, B. N 2007 Viruses and symptoms on peppers, and their infection types in Korea. Res. Plant Dis. 13: 75-81. (In Korean).
Kang, K. Y, Choi, J. I and La, Y. J 1973 Isolation and identification of viruses affecting pepper (Capsicum annuum L) in Korea. J. Kor. Soc. Hort. Sci. 13: -35. -43. (In Korean).
Kwak, H. R, Kim, M. K, Nam, M, Kim, J. S, Kim, K. H, Cha, B. J and Choi, H. S 2013. Genetic compositions of Broad bean wilt virus 2 infecting red pepper in Korea. Plant Pathol. J. 29: 274-284.
crossref pmid pmc
Kim, J. H, Choi, G. S, Kim, J. S and Choi, J. K 2004. Characterization of Tomato spotted wilt virus from paprika in Korea. Plant Pathol. J. 20: 297-301.
Kim, J. S, Kim, S. K, Choi, G. S and Lee, M. W 1990 Virus disease incidence and symptom appearance in red pepper. Korean J. Plant Pathol. 6: 125-132. (In Korean).
Kim, J. S, Lee, S. H, Choi, H. S, Choi, G. S, Cho, J. D and Chung, B. N 2008 Survey of viral diseases occurrence on major crops in 2007. Res. Plant Dis. 14: 1-9. (In Korean).
Kim, J. S, Lee, S. H, Choi, H. S, Kim, M. K, Kwak, H. R, Kim, J. S, Nam, M, Cho, J. D, Cho, I. S and Choi, G. S 2012 2007-2011 characteristics of plant virus infections on crop samples submitted from agricultural places. Res. Plant Dis. 18: 277-289. (In Korean).
Ko, S. J, Kang, B. R, Choi, D. S, Kim, D. I, Lee, G. S, Kim, C. S and Choi, H. S 2013 Pattern of the occurrence of Tomato spotted wilt virus in Jeonnam province. Res. Plant Dis. 19: 273-280. (In Korean).
Korean Statistical Information Service. Crop production survey. [cited Mar 2, 2017]. URL (In Korean).
La, Y. J, Choi, J. I and Kang, K. Y 1972 Serological investigation of virus diseases of pepper plant (Capsicum annuum L.) in Korea. J. Plant Biol. 15: 23-27. (In Korean).
Lee, J. H, Hong, S. J, Ju, H. J and Park, D. H 2015 Occurrence of viral diseases in field-cultivated pepper in Korea from 2006 to 2010. Korean J. Organic Agri. 23: 123-131. (In Korean).
Lee, S. H, Lee, J. B, Kim, S. M, Choi, H. S, Park, J. W, Lee, J. S, Lee, K. W and Moon, J. S 2004 The incidence and distribution of viral diseases in pepper by cultivation types. Res. Plant Dis. 10: 231-240. (In Korean).
The Korean Society of Plant Pathology. 2009. List of Plant Diseases in Korea. 5th ed. The Korean Society of Plant Pathology, Suwon, Korea. p. 73-90.
Yi, Y. K and Yim, Y. G 2007 Survey of disease occurrence in tobacco plants of the Kyeongbuk area during 2005-2006. Res. Plant Dis. 13: 1-5. (In Korean).

Editorial Office
Rm,904 (New Bldg.) The Korean Science & Technology Center 22, Teheran-ro 7-gil, Gangnam-gu, Seoul 06130, Korea
Tel: +82-2-557-9360    Fax: +82-2-557-9361    E-mail:                

Copyright © 2022 by The Korean Society of Plant Pathology.

Developed in M2PI

Close layer
prev next