Occurrence of Papaya Anthracnose Caused by Colletotrichum spp. in Korea

Article information

Res. Plant Dis. 2026;32(1):21-28
Publication date (electronic) : 2026 March 31
doi : https://doi.org/10.5423/RPD.2026.32.1.21
1Plant Disease Control Division, National Institute of Agricultural Sciences, Wanju 55365, Korea
2Global Agro-Consulting Corporation, Suwon 16614, Korea
*Corresponding author Tel: +82-31-292-7848 Fax: +82-31-292-7849 E-mail: wgkim5121@naver.com
Received 2026 January 23; Revised 2026 March 15; Accepted 2026 March 16.

Abstract

Anthracnose symptoms were found on fruit of papaya trees (Carica papaya) cultivated in greenhouses in Taean and Gokseong, Korea, during surveys of crop diseases in 2020 and 2021. The initial symptoms on the fruit appeared as small, water-soaked, slightly depressed, circular or oval brown spots. As the disease progressed, the symptoms turned sunken, dark brown to black, and enlarged. In the later stages, yellowish conidial masses formed on the lesions. The disease symptoms on the fruit occurred up to 5% in the investigated greenhouses. Seven single-conidium isolates were obtained from the diseased fruit and found to correspond to Colletotrichum sp. based on their morphological characteristics. Two out of the seven isolates were identified as Colletotrichum aenigma, and the others as Colletotrichum fructicola by analysis of phylogenetic characteristics. The isolates of C. aenigma and C. fructicola were tested for their pathogenicity on papaya fruit using artificial inoculation. Both the Colletotrichum spp. isolates induced anthracnose symptoms in papaya fruit, similar to those observed in the investigated greenhouses. This is the first report of C. aenigma and C. fructicola causing papaya anthracnose in Korea.

Introduction

A tree, papaya (Carica papaya) belongs to the family Caricaceae, and its native range is South Mexico to Venezuela (Plants of the World Online, 2026). The plant grows mainly in the tropical regions and has been introduced into many tropical and subtropical countries to cultivate as a fruit tree. Papaya fruit is widely used for food, medicine, cooking, and so on, in the production areas. In Korea, papaya trees have been cultivated in greenhouses since 2008 due to the high price of the fruit and the increasing demand.

Many fungal diseases such as Alternaria fruit spot, anthracnose, dry rot, Fusarium fruit rot have been reported to occur in papaya fruit worldwide (Persley and Ploetz, 2003; Ploetz et al., 2008), but only Fusarium fruit rot has been reported in Korea (Lee et al., 2024). In 2020 and 2021, we encountered outbreaks of anthracnose symptoms on fruit of papaya trees cultivated in greenhouses in Taean and Gokseong, Korea, during surveys of crop diseases. We examined morphological characteristics of fungal isolates from the diseased fruits and found that they belonged to the genus Colletotrichum (Sutton, 1992; Von Arx, 1970).

Colletotrichum spp. have been known to be very difficult to distinguish by their morphological characteristics alone. Therefore, their taxonomy has been studied based on phylogenetic analysis in combination with morphology (Cannon et al., 2012; Jayawardena et al., 2016; Weir et al., 2012). This study was conducted to identify the unknown Colletotrichum sp. isolates from anthracnose symptoms of papaya fruit based on phylogenetic analysis and morphological characteristics. In addition, pathogenicity of the isolates was tested to papaya fruit to determine the pathogen causing anthracnose in papaya.

Materials and Methods

Disease survey and isolation of fungi.

In 2020 and 2021, we surveyed disease occurrence on fruit of papaya trees growing in greenhouses located in Taean and Gokseong, Korea. During the disease surveys in a greenhouse in each location, we found anthracnose symptoms on the fruits in the harvest season. Three sites were observed in each greenhouse, and 100 fruits at each site were investigated for the disease incidence. The diseased fruits were collected from the investigated greenhouses, and fungi were isolated from the fruits with anthracnose symptoms. Conidial mass of fungi formed on the diseased fruits was diluted in sterile distilled water to prepare a conidial suspension. The 50 μl of conidial suspension from the conidial mass was poured into 2% water agar (WA) plates and streaked using a sterile loop. After incubating the WA plates at 25°C for one day, germinated conidia on WA were observed under a stereo microscope (SMZ 1780; Nikon, Tokyo, Japan) and transferred to new WA plates. The single-conidium isolates grown in the WA plates at 25°C for 3 days were transferred to potato dextrose agar (PDA) slants and cultured at 25°C. Among the 21 isolates obtained from the diseased fruits, seven were selected in consideration of the location and the timing of the disease outbreak (Table 1), and used for identification.

List of Colletotrichum sp. isolates from papaya fruits with anthracnose symptoms in Korea

Examination of morphological characteristics.

The seven isolates were cultured on PDA in 9-cm-diameter Petri dishes at 25°C in the dark for 30 days, and conidia produced in the PDA cultures were investigated for their morphological characteristics using a light microscope (Eclipse Ci-L; Nikon). The 50 conidia of each isolate produced in the PDA cultures were examined for their shape and size by using a light microscope. A conidial suspension (1–3×106 conidia/ml) of each isolate was prepared from the PDA culture. The 20 µl conidial suspension was dropped onto WA, and a sterile cover glass (CG) was placed on it. The WA-CG-culture plates were incubated at 25°C for 2 days, and then the morphology of 50 appressoria from each isolate was examined using a light microscope.

Analysis of DNA sequences and phylogenetic characteristics.

The seven isolates were used for phylogenetic analysis. Genomic DNA of the isolates was extracted using the methods in a previous study (Kim et al., 2024). Amplification of the ribosomal internal transcribed spacer (ITS), actin (ACT), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), β-tubulin (TUB2), and Apn2-Mat1-2 intergenic spacer and partial mating type (ApMat) gene regions of the isolates was conducted using the respective primer pairs (Table 2). The polymerase chain reaction (PCR) products were prepared with DNA Free-Multiplex Master Mix (Cellsafe, Yongin, Korea) and the Universal DNA Purification Kit (Tiangen, Beijing, China), following the manufacturers’ protocols. The PCR products were sequenced at Bionics Co. (Seoul, Korea) using the same primers.

Sequence information of the primer pairs used for molecular identification of Colletotrichum sp. isolates from papaya fruits

Sequences of the isolates from papaya fruit and other relevant Colletotrichum species from Genbank were refined using MEGA version 7 (Kumar et al., 2016). Maximum-likelihood analysis for the concatenated alignments of the ITS, ACT, GAPDH, TUB2, and ApMat genes was conducted using a general time-reversible+GAMMA model with 1,000 bootstrap replicates, performed by MEGA version 7 software. Colletotrichum boninense CBS 123755 and Colletotrichum acutatum CBS 112996 were used as outgroup taxa.

Pathogenicity test on papaya fruit.

Two isolates of each Colletotrichum species identified through phylogenetic analysis were tested for their pathogenicity on papaya fruit. Healthy mature papaya fruits in length of 14–19 cm were surface-sterilized using 1% sodium hypochlorite for 5 min and then washed with sterile distilled water. The papaya fruits were drained with paper towels and placed in plastic boxes (50×36×25 cm). One fruit per isolate was used for inoculation test. Conidial suspension (1–3×106 conidia/ml) prepared from the 30-day-old PDA cultures was used for inoculation tests. The 30 μl of each conidial suspension was dropped in three points 4 cm apart on a fruit for non-wound inoculation. For wound inoculation, the conidial suspension was dropped in the same way as the non-wound inoculation on the fruit stabbed to a depth of 2–3 mm with a sterile needle. Control fruits were treated with the same amount of sterile water by the same inoculation methods. The plastic boxes containing the inoculated fruits were covered and placed in a culture room under 60–80% relative humidity at 24–26°C. The result of inoculation tests was investigated based on formation of lesions on the fruits at 7 days after inoculation. The inoculation test was conducted thrice.

Results and Discussion

Disease occurrence and symptoms.

In 2020 and 2021, we encountered outbreaks of anthracnose symptoms on fruit of papaya trees cultivated in greenhouses at locations Taean and Gokseong, Korea, during surveys of crop diseases. The initial symptoms on the fruit appeared as small, water-soaked, slightly depressed, circular or oval dark brown spots. As the disease progressed, the symptoms turned sunken, dark brown to black, and enlarged (Fig. 1A-C). In the later stages, yellowish conidial masses formed on the lesions. The disease on the fruits occurred up to 5% in the investigated greenhouses at the two locations (Table 3).

Fig. 1.

Anthracnose symptoms on fruits of papaya trees. (A-C) Symptoms observed in the investigated greenhouses. (D, E) Symptoms induced by non-wound inoculation tests with Colletotrichum aenigma isolate (CPCO-2001) and Colletotrichum fructicola isolate (CPCO-2101) 7 days after inoculation, respectively. The arrows indicate the lesions formed from the inoculation points on the fruit. (F) A non-inoculated fruit (control).

Occurrence of anthracnose on fruits of papaya trees grown in greenhouses at two locations of Korea in 2020 and 2021

Phylogenetic characteristics and identification.

The seven isolates from papaya fruits were identified by phylogenetic analysis (Fig. 2). The concatenated alignments of the isolates and relevant Colletotrichum spp. contained a total of 2,799 characters (563, 255, 295, 503, and 1,183 characters for ITS, ACT, GAPDH, TUB2, and ApMat, respectively). The first group comprising two isolates (CPCO-2001 and CPCO-2004) clustered with Colletotrichum aenigma ICMP 18608. The second group comprising five isolates (CPCO-2007, CPCO-2011, CPCO-2013, CPCO-2101, and CPCO-2103) clustered with the strains ICMP 18581 and ICMP 18646 of Colletotrichum fructicola. Therefore, the two groups of isolates were identified as C. aenigma and C. fructicola, respectively, with significant bootstrap values of more than 95%. The sequence data of ITS, ACT, GAPDH, TUB2, and ApMat genes obtained from the isolates of C. aenigma and C. fructicola were deposited in GenBank with accession numbers (Table 4).

Fig. 2.

Phylogenetic tree based on concatenated sequences with actin, glyceraldehyde-3-phosphate dehydrogenase, β-tubulin, ribosomal internal transcribed spacer, and Apn2-Mat1-2 intergenic spacer and partial mating type gene regions of the seven Colletotrichum isolates (CPCO-2001, CPCO-2004, CPCO-2007, CPCO-2011, CPCO-2013, CPCO-2101, and CPCO-2103) from papaya fruits and reference strains of Colletotrichum species. Sequence data of the reference strains were obtained from the NCBI GenBank database. The phylogenetic tree was generated using the maximum-likelihood method with a general time-reversible model. The bootstrap support values are shown at the nodes. The scale bar represents the number of nucleotide substitutions per site. The asterisk mark represents the reference strains.

Accession number of sequence data obtained from the isolates of Colletotrichum aenigma and Colletotrichum fructicola from papaya fruits deposited in GenBank and reference strains of Colletotrichum species

Morphological characteristics.

The morphological characteristics of the two Colletotrichum spp. isolates were generally consistent with those reported in previous studies (Choi and Park, 2021; Lee et al., 2021; Prihastuti, et al., 2009; Weir et al., 2012), although they differed slightly in conidial size (Table 5). The conidia of C. aenigma isolates were cylindrical with round ends, sometimes slightly curved (Fig. 3A) and measured 10.8–20.7×3.0–6.8 μm (average 15.5×5.3 μm). The appressoria of C. aenigma isolates were subglobose and lobate, brown to dark brown (Fig. 3B) and measured 7.0–17.2×4.4–9.8 μm (average 11.0×7.5 μm). The conidia of C. fructicola isolates were cylindrical with obtuse or slightly round ends, sometimes slightly curved (Fig. 3C) and measured 13.3–21.0×4.6–6.3 μm (average 16.0×5.4 μm). The appressoria of C. fructicola isolates were ovoid, clavate and slightly irregular, brown to dark brown (Fig. 3D) and measured 6.0–13.0×5.0–9.0 μm (average 9.5×6.6 μm).

Morphological characteristics of Colletotrichum aenigma and Colletotrichum fructicola isolates from papaya fruits and previous studies

Fig. 3.

Morphological features of Colletotrichum spp. isolates from diseased papaya fruits. (A, B) Conidia and appressoria of Colletotrichum aenigma, respectively. (C, D) Conidia and appressoria of Colletotrichum fructicola, respectively.

Pathogenicity.

All tested isolates of C. aenigma and C. fructicola induced anthracnose symptoms on papaya fruits by non-wound inoculation as well as wound inoculation (Table 6). In general, the anthracnose symptoms were more severely induced by wound inoculation than by non-wound inoculation. The symptoms on the fruits in non-wound inoculation tests with the two Colletotrichum spp. were similar to those observed on the fruits in the investigated greenhouses (Fig. 1D, E). No symptoms were observed on the control fruits (Fig. 1F). Inoculated isolates of the two Colletotrichum spp. were re-isolated from the lesions induced by the inoculation tests and confirmed as morphologically identical to the original isolates.

Result of pathogenicity tests of two Colletotrichum spp. isolates to papaya fruits using artificial inoculation

Colletotrichum spp. are known to cause anthracnose in numerous plants (Sutton, 1992; Von Arx, 1970). It has been reported that Colletotrichum gloeosporioides causes anthracnose in papaya fruit (Cooke et al., 2009; Persley and Ploetz, 2003; Ploetz et al., 2008; Tan et al., 2023). Colletotrichum chrysophilum has also been reported as a pathogen causing papaya anthracnose in Mexico (Pacheco-Esteva et al., 2022). C. gloeosporioides was recognized as a species complex and divided into many species on the basis of multi-gene phylogenies (Weir et al., 2012).

In the present study, Colletotrichum sp. isolates causing anthracnose in papaya fruit were identified as C. aenigma and C. fructicola through phylogenetic analysis and morphological characteristics. C. aenigma and C. fructicola were newly named based on phylogenetic analysis and have been reported to cause anthracnose in various crops worldwide (Prihastuti et al., 2009; Weir et al., 2012). However, there have been no reports on occurrence of papaya anthracnose caused by the two Colletotrichum spp. In Korea, it has been reported that C. aenigma causes anthracnose in apple, grape, and orange stonecrop, and C. fructicola in apple, grape, mango, peach, pear, and spotted laurel (Korean Society of Plant Pathology, 2026). This is the first report of C. aenigma and C. fructicola causing papaya anthracnose in Korea.

Notes

Conflicts of Interest

No potential conflict of interest relevant to this article was reported.

Acknowledgments

This study was supported by a research grant (PJ01450701) from the Rural Development Administration, Korea.

References

Cannon P. F., Damm U., Johnston P. R., Weir B. S.. 2012;Colletotrichum - current status and future directions. Stud. Mycol. 73:181–213.
Carbone I., Kohn L. M.. 1999;A method for designing primer sets for speciation studies in filamentous ascomycetes. Mycologia 91:553–556.
Choi E. D., Park S.-Y.. 2021;First report of anthracnose caused by Colletotrichum fructicola on hybrid pear fruit in Korea. Plant Dis. 105:3291.
Cooke T., Persley D., House S.. 2009. Diseases of Fruit Crops in Australia CSIRO Publishing. Collingwood, Australia:
Glass N. L., Donaldson G. C.. 1995;Development of primer sets designed for use with the PCR to amplify conserved genes from filamentous ascomycetes. Appl. Environ. Microbiol. 61:1323–1330.
Guerber J. C., Liu B., Correll J. C., Johnston P. R.. 2003;Characterization of diversity in Colletotrichum acutatum sensu lato by sequence analysis of two gene introns, mtDNA and intron RFLPs, and mating compatibility. Mycologia 95:872–895.
Jayawardena R. S., Hyde K. D., Damm U., Cai L., Liu M., Li X. H., et al. 2016;Notes on currently accepted species of. Colletotrichum. Mycosphere 7:1192–1260.
Kim W.-G., Lee G.-B., Hong S.-K., Mo Y.-M., Cho W.-D.. 2024;Anthracnose of Korean epimedium caused by Colletotrichum gloeosporioides. Kor. J. Mycol. 52:233–237.
Korean Society of Plant Pathology. 2026. List of Plant Diseases in Korea URL http://genebank.rda.go.kr/kplantdisease.do [20 January 2026].
Kumar S., Stecher G., Tamura K.. 2016;MEGA7: molecular evolutionary genetics analysis version 7.0 for bigger datasets. Mol. Biol. Evol. 33:1870–1874.
Lee G.-B., Shim H.-S., Cho W.-D., Kim W.-G.. 2024;Fruit rot of papaya caused by Fusarium spp. in Korea. Res. Plant Dis. 30:453–456.
Lee S.-Y., Ten L. N., Ryu J.-J., Kang I.-K., Jung H.-Y.. 2021;Colletotrichum aenigma associated with apple bitter rot on newly bred cv. RubyS apple. Res. Plant Dis. 27:70–75.
O'Donnell K., Cigelnik E.. 1997;Two divergent intragenomic rDNA ITS2 types within a monophyletic lineage of the fungus Fusarium are nonorthologous. Mol. Phylogenet. Evol. 7:103–116.
Pacheco-Esteva M. C., Soto-Castro D., Vásquez-López A., Lima N. B., Tovar-Pedraza J. M.. 2022;First report of Colletotrichum chrysophilum causing papaya anthracnose in Mexico. Plant Dis. 106:3213.
Persley D. M., Ploetz R. C.. 2003. Diseases of papaya. Diseases of Tropical Fruit Crops In : Ploetz R. C., ed. p. 373–412. CABI. Wallingford, UK:
Plants of the World Online. 2026. Carica papaya L URL https://powo.science.kew.org/ [20 January 2026].
Ploetz R. C., Zentmyer G. A., Nishijima W. T., Rohrbach K. G., Ohr H. D.. 2008. Compendium of Tropical Fruit Diseases APS Press. St. Paul, MN, USA:
Prihastuti H., Cai L., Chen H., McKenzie E. H. C., Hyde K. D.. 2009;Characterization of Colletotrichum species associated with coffee berries in northern Thailand. Fungal Divers. 39:89–109.
Silva D. N., Talhinhas P., Várzea V., Cai L., Paulo O. S., Batista D.. 2012;Application of the Apn2/MAT locus to improve the systematics of the Colletotrichum gloeosporioides complex: an example from coffee (Coffea spp.) hosts. Mycologia 104:396–409.
Sutton B. C.. 1992. The genus Glomerella and its anamorph Colletotrichum. Colletotrichum: Biology, Pathology and Control In : Bailey J. A., Jeger M. J., eds. p. 1–26. CAB International. Wallingford, UK:
Tan G. H., Ali A., Siddiqui Y.. 2023;Major fungal postharvest diseases of papaya: current and prospective diagnosis methods. Crop Protect. 174:106399.
Von Arx J. A.. 1970;A revision of the fungi classified as Gloeosporium. Bibl. Mycol. 24:1–203.
Weir B. S., Johnston P. R., Damm U.. 2012;The Colletotrichum gloeosporioides species complex. Stud. Mycol. 73:115–180.
White T. J., Bruns T., Lee S., Taylor J.. 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. PCR Protocols: A Guide to Methods and Applications In : Innis M. A., Gelfand D. H., Sninsky J. J., White T. J., eds. p. 315–322. Academic Press. San Diego, CA, USA:

Article information Continued

Table 1.

List of Colletotrichum sp. isolates from papaya fruits with anthracnose symptoms in Korea

Isolate Collection location Month and year isolated
CPCO-2001 Taean March 2020
CPCO-2004 Taean March 2020
CPCO-2007 Taean March 2020
CPCO-2011 Gokseong December 2020
CPCO-2013 Gokseong December 2020
CPCO-2101 Gokseong March 2021
CPCO-2103 Gokseong March 2021

Table 2.

Sequence information of the primer pairs used for molecular identification of Colletotrichum sp. isolates from papaya fruits

Gene region Primer Sequence (5'–3') Reference
ITS ITS1 CTTGGTCATTTAGAGGAAGTAA White et al. (1990)
ITS4 TCCTCCGCTTATTGATATGC White et al. (1990)
ACT ACT-512F ATGTGCAAGGCCGGTTTCGC Carbone and Kohn (1999)
ACT-783R TACGAGTCCTTCTGGCCCAT Carbone and Kohn (1999)
GAPDH GDF GCCGTCAACGACCCCTTCATTGA Guerber et al. (2003)
GDR GGGTGGAGTCGTACTTGAGCATGT Guerber et al. (2003)
TUB2 T1 AACATGCGTGAGATTGTAAGT O'Donnell and Cigelnik (1997)
Bt2b ACCCTCAGTGTAGTGACCCTTGGC Glass and Donaldson (1995)
ApMat AM-F TCATTCTACGTATGTGCCCG Silva et al. (2012)
AM-R CCAGAAATACACCGAACTTGC Silva et al. (2012)

ITS, internal transcribed spacer; ACT, actin; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; TUB2, β-tubulin; ApMat, Apn2-Mat1-2 intergenic spacer and partial mating type.

Fig. 1.

Anthracnose symptoms on fruits of papaya trees. (A-C) Symptoms observed in the investigated greenhouses. (D, E) Symptoms induced by non-wound inoculation tests with Colletotrichum aenigma isolate (CPCO-2001) and Colletotrichum fructicola isolate (CPCO-2101) 7 days after inoculation, respectively. The arrows indicate the lesions formed from the inoculation points on the fruit. (F) A non-inoculated fruit (control).

Table 3.

Occurrence of anthracnose on fruits of papaya trees grown in greenhouses at two locations of Korea in 2020 and 2021

Location Period investigated Diseased fruitsa (%)
Taean March 2020 1–5
Gokseong December 2020 Less than 1
March 2021 Less than 1
a

Three sites were observed in a greenhouse, and 100 fruits at each site were investigated for disease incidence.

Fig. 2.

Phylogenetic tree based on concatenated sequences with actin, glyceraldehyde-3-phosphate dehydrogenase, β-tubulin, ribosomal internal transcribed spacer, and Apn2-Mat1-2 intergenic spacer and partial mating type gene regions of the seven Colletotrichum isolates (CPCO-2001, CPCO-2004, CPCO-2007, CPCO-2011, CPCO-2013, CPCO-2101, and CPCO-2103) from papaya fruits and reference strains of Colletotrichum species. Sequence data of the reference strains were obtained from the NCBI GenBank database. The phylogenetic tree was generated using the maximum-likelihood method with a general time-reversible model. The bootstrap support values are shown at the nodes. The scale bar represents the number of nucleotide substitutions per site. The asterisk mark represents the reference strains.

Table 4.

Accession number of sequence data obtained from the isolates of Colletotrichum aenigma and Colletotrichum fructicola from papaya fruits deposited in GenBank and reference strains of Colletotrichum species

Colletotrichum species Isolate/strain GenBank accession number
ITS TUB2 ACT GAPDH ApMat
C. aenigma CPCO-2001 PQ818753 PQ843222 PQ843229 PQ849923 PQ849930
CPCO-2004 PQ818754 PQ843223 PQ843230 PQ849924 PQ849931
C. fructicola CPCO-2007 PQ818781 PQ843224 PQ843231 PQ849925 PQ849932
CPCO-2011 PQ818782 PQ843225 PQ843232 PQ849926 PQ849933
CPCO-2013 PQ818783 PQ843226 PQ843233 PQ849927 PQ849934
CPCO-2101 PQ818784 PQ843227 PQ843234 PQ849928 PQ849935
CPCO-2103 PQ818785 PQ843228 PQ843235 PQ849929 PQ849936
C. acutatum CBS 112996 JQ005776 JQ005860 JQ005839 JQ948677 MK478330
C. aenigma ICMP 18608 JX010244 JX010389 JX009443 JX010044 KM360143
C. aeschynomenes ICMP 17673 JX010176 JX010392 JX009483 JX009930 KM360145
C. alatae ICMP 17919 JX010190 JX010383 JX009471 JX009990 KC888932
C. alienum ICMP 12071 JX010251 JX010411 JX009572 JX010028 KM360144
C. asianum ICMP 18580 FJ972612 JX010406 JX009584 JX010053 FR718814
C. boninense CBS 123755 JQ005153 JQ005588 JQ005501 JQ005240 -
C. clidemiae ICMP 18658 JX010265 JX010438 JX009537 JX009989 KC888929
C. fructicola ICMP 18581 JX010165 JX010405 FJ907426 JX010033 JQ807838
C. fructicola ICMP 18646 JX010165 JX010409 JX009581 JX010032 -
C. gloeosporioides IMI 356878 JX010152 JX010445 JX009531 JX010056 JQ807843
C. horii ICMP 10492 GQ329690 JX010450 JX009438 GQ329681 JQ807840
C. musae ICMP 19119 JX010146 HQ596280 JX009433 JX010050 KC888926
C. psidii ICMP 19120 JX010219 JX010443 JX009515 JX009967 KC888931
C. queenslandicum ICMP 1778 JX010276 JX010414 JX009447 JX009934 KC888928
C. salsolae ICMP 19051 JX010242 JX010403 JX009562 JX009916 KC888925
C. siamense ICMP 18578 JX010171 JX010404 FJ907423 JX009924 JQ899289
C. ti ICMP 4832 JX010269 JX010442 JX009520 JX009952 KM360146

ITS, internal transcribed spacer; TUB2, β-tubulin; ACT, actin; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; ApMat, Apn2-Mat1-2 intergenic spacer and partial mating type.

Fig. 3.

Morphological features of Colletotrichum spp. isolates from diseased papaya fruits. (A, B) Conidia and appressoria of Colletotrichum aenigma, respectively. (C, D) Conidia and appressoria of Colletotrichum fructicola, respectively.

Table 5.

Morphological characteristics of Colletotrichum aenigma and Colletotrichum fructicola isolates from papaya fruits and previous studies

Colletotrichum species Host (reference) Morphological characteristics
Conidia Appressoria
C. aenigma Papaya (present study) Cylindrical with round ends, sometimes slightly curved, 10.8–20.7×3.0–6.8 μm (average 15.5×5.3 μm) Subglobose and lobate, brown to dark brown, 7.0–17.2×4.4–9.8 μm (average 11.0×7.5 μm)
Avocado (Weir et al., 2012) Cylindric with broadly rounded ends, 12.0–16.5×5.0–7.5 μm (average 14.5×6.1 μm) Subglobose or with a few broad lobes, 6.0–10.0 μm diameter
Apple (Lee et al., 2021) Cylindrical with round ends, sometimes slightly curved, 14.9–21.1×5.7–8.5 μm (average 18.6×7.3 μm) Clavate, crenate with lobes, brown to dark brown, 9.2–17.7×5.2–8.8 μm (average 12.0×7.5 μm)
C. fructicola Papaya (present study) Cylindrical with obtuse or slightly round ends, sometimes slightly curved, 13.3–21.0×4.6–6.3 μm (average 16.0×5.4 μm) Ovoid, clavate and slightly irregular, brown to dark brown, 6.0–13.0×5.0–9.0 μm (average 9.5×6.6 μm)
Coffee (Prihastuti et al., 2009) Cylindrical with obtuse to slightly rounded ends, sometimes oblong, 9.7–14.0×3.0–4.3 μm (average 11.53×3.55 μm) Ovoid, clavate and slightly irregular to irregular, brown to dark brown, 4.3–9.7×3.7–7.3 μm (average 7.35×4.49 μm)
Pear (Choi and Park, 2021) Cylindrical with rounded ends, 13.8–20.1×4.8–6.2 μm (average 18.3×5.4 μm) Globose or subcylindrical, dark brown, 6.3–9.5×5.2–6.9 μm (average 8.1×6.1 μm)

Table 6.

Result of pathogenicity tests of two Colletotrichum spp. isolates to papaya fruits using artificial inoculation

Colletotrichum species Isolate Diameter (mm) of lesions produced on papaya fruitsa
Non-wounded Wounded
C. aenigma CPCO-2001 5.3±0.6 18.7±5.0
C. aenigma CPCO-2004 12.7±1.4 26.7±4.2
C. fructicola CPCO-2011 5.7±1.2 22.3±0.6
C. fructicola CPCO-2101 8.3±3.0 18.3±5.8
Control

Values are presented as mean±standard deviation.

–, no lesion.

a

Diameter of lesions formed on the fruits was measured 7 days after inoculation.