*Corresponding author Barley (Hordeum vulgare) is one of the major cereal crops following the rice and wheat (Giraldo et al., 2019). It has contributed to increased food self-sufficiency by utilizing winter fallow land after the rice grown in Korea (Kim et al., 2020; Song et al., 2021). In 2025, domestic production reached 92,000 tons in Korea (Korean Statistical Information Service, 2025). Barley is used for food, brewing, animal feed, and land-scaping in worldwide including Korea (Giraldo et al., 2019; Nikkhah, 2012). The major fungal diseases of barley include brown rust, yellow rust, powdery mildew and net blotch (The Korean Society of Plant Pathology, 2022). However, global climate change particularly the increase in temperature during in winter and spring seasons, has raised the risk of the emergence of new fungal disease in barley and other cereal crops (Jeong et al., 2023a, 2023b, 2024).
In April 2021, several leaves of barley planted on fields in Boseong-gun (34.775918° N, 127.152100° E) and Jangheung-gun (34.509412° N, 126.960575° E), Jeonnam Province, Korea showed leaf spots. The infected leaves showed brown ellipse spots and leaves turned to yellow centered around spots. The size of lesions varies depending on the progress of disease. The disease progressed to affect nearly 50% of each leaf (Fig. 1A, B). For isolate the pathogen potentially responsible for these symptoms, three leaf lesions from each leaf were cut into 5×5 mm pieces, surface-sterilized with 70% ethanol for 1 min, and 1% NaOCl for 1 min, and three times with sterilized distilled water, dried, and placed on water agar with 100 µg/ml of streptomycin. Then it was incubated at 25°C for 5 days. Emerging hyphae from the samples were sub-cultured on 8% V8 juice agar (8% Campbell's V8-Juice, 1.5% agar, pH adjusted to 7 using 0.1N NaOH), resulting in three independent isolates (SYP-572, SYP-573 and SYP-581) after single spore isolation from three independent isolated cultures.
Fig. 1.
Naturally occurring leaf spot disease on Hordeum vulgare, morphological characteristics of fungal isolates from infected barley, and pathogenicity assay. (A, B) Leaf spot symptoms on barley leaves. Front (C) and reverse (D) sides of a 4-week-old colony grown on potato dextrose agar. (E) Conidiophores bearing long chains of conidia. (F) Morphological details of conidia from the isolate SYP-572. (G) Pseudo-thecia formed on sterilized barley stems placed on water agar for 1 week. (H) Pathogenicity test of representative strain SYP-572 on 2-week-old H. vulgare cv. Keunalbori-1ho. Mock inoculation without (far left) and with wounds (left), and inoculation with SYP-572 conidial suspension without (right) and with wounds (far right) after incubation at 100 % relative humidity for 10 days.
On potato dextrose agar (PDA; Difco Laboratories, Detroit, MI, USA) for 4 weeks at 25°C, colonies of isolates appeared dark brown, with velvety texture (Fig. 1C, D). The colony surface was dense and exhibited a radial furrowed pattern, with distinct sectors extending from the center (Fig. 1C). Conidiophores bearing long chains of conidia (Fig. 1E) and conidia were appeared at 2 weeks after inoculation on PDA (Fig. 1F). Conidia usually developed in the form of conid-iophores in 6 to 20 more long chains. In terms of color and shape, these chains were grayish brown and ellipsoid to obclavate. There were 0 to 1 transverse, and 0 vertical septa. The size of conidia was 4.3 to 20.8 μm×1.8 to 7.8 μm (average 1.0×4.4 μm, n=100) (Fig. 2). On water agar (1.5% agar) with sterilized barley stem, pseudothecia were appeared on stem (Fig. 1G).
Fig. 2.
Phylogenetic analysis. A maximum-likelihood (ML) tree was constructed in MEGA X based on concatenated sequences of ITS, tef1, and act from isolates SYP-572, SYP-573, and SYP-581, together with corresponding sequences of the Cladosporium herbarum complex retrieved from GenBank. Clades are shaded. Bootstrap analysis was performed with 1,000 replicates, and the numbers at each node indicate bootstrap support values. ITS, internal transcribed spacer; tef1, translation elongation factor 1-alpha; act, actin.
The morphological characteristics of the isolates were consistent with those of Cladosporium species (Bensch et al., 2012). For molecular identification, the internal transcribed spacer (ITS), translation elongation factor 1-alpha (tef1), and actin (act) gene sequences obtained using the primers listed in Table 1 from isolates SYP-572, SYP-573, and SYP-581 were compared with those of the type strain Cladosporium allicinum CBS 121624 (Table 2). The ITS sequence showed 100.0% identity (503 bp/503 bp) to GenBank accession EF679350, the tef1 sequence showed 91.82% identity (292 bp/318 bp) to EF679425, and the act sequence showed 97.42% identity (227 bp/233 bp) to EF679502. For phylogenetic analysis, type-strain sequences were retrieved from the NCBI database as described by Bensch et al. (2012). A maximum-likelihood phylogeny based on the concatenated ITS, tef1, and act sequences placed the three isolates within the C. allicinum CBS 121624 clade (Fig. 2).
Table 1.
Primers used for PCR and sequencing
| Locus | Primer | Primer sequence (5’-3’) | Reference |
|---|---|---|---|
| ITS | ITS5 | GGAAGTAAAAGTCGTAACAAGG | White et al. (1990) |
| ITS4 | CCTCCGCTTATTGATATGC | ||
| tef1 | EF1-728F | CATCGAGAAGTTCGAGAAGG | Carbone and Kohn (1999) |
| EF1-986R | TACTTGAAGGAACCCTTACC | ||
| act | ACT-512F | ATGTGCAAGGCCGGTTTCG | Carbone and Kohn (1999) |
| ACT-783R | TACGAGTCCTTCTGGCCCAT |
Table 2.
Strains used in this study and their GenBank accession numbers
The tef1 gene sequences of the three isolates shared 91.82% identity with that of the C. allicinum type strain CBS 121624, which is lower than the identities observed for the ITS and act loci. A Basic Local Alignment Search Tool search further revealed that all strains deposited as C. allicinum showed ≤91.82% identity to the type-strain tef1 sequence. Such levels of divergence are common in Cladosporium, where intron length variation and base substitutions frequently generate intraspecific polymorphism, as documented in previous multi-locus studies (Becchimanzi et al., 2021; Bensch et al., 2018; Iturrieta-González et al., 2021). Consistent with this interpretation, our maximum-likelihood phylogeny based on concatenated ITS- tef1- act sequences placed all isolates within the C. allicinum CBS 121624 clade, confirming that the observed tef1 divergence represents natural intraspecific variation rather than sequencing error or species-level separation.
Pathogenicity of isolate SYP-572 was assessed as a representative strain using three leaves from each of three independent healthy barley plants. Barley seeds (cv. Keunalbori-1ho) were surface-sterilized and grown in soil for 14 days at 15°C. Leaves were inoculated with 2 ml of a conidial suspension (1×106 conidia ml-1 containing 0.025% Tween 20), both with and without prior wounding. Three additional leaves treated with 0.025% Tween 20 served as controls. Inoculated plants were maintained at 20°C and 100% relative humidity for 10 days. Leaf-spot symptoms developed on both wounded and unwounded leaves but were absent from the controls. The pathogenicity test was repeated three times. The pathogen was re-isolated from symptomatic tissue, single-spored, and its identity confirmed by sequencing of the ITS, tef1, and act genes, thereby satisfying Koch's postulates (Fig. 1H).
In conclusion, to the best of our knowledge, this is the first report of leaf spot caused by C. allicinum on H. vulgare in Korea. This finding provides valuable genetic resources and a basis for developing effective control strategies for leaf spot disease in H. vulgare.
PDF Links
PubReader
ePub Link
Full text via DOI
Download Citation
Print
