Survey of Plant Diseases in Horticultural Crops in Cheorwon, South Korea, in 2024

Miah Bae; Namsuk Kim; Sangyeon Ju; Byungyeon Kim; Hyunmo Gu; MeeKyoung Kim; Mi-Ri Park

doi:10.5423/RPD.2025.31.2.131

Res. Plant Dis > Volume 31(2); 2025 > Article

Bae, Kim, Ju, Kim, Gu, Kim, and Park: Survey of Plant Diseases in Horticultural Crops in Cheorwon, South Korea, in 2024

Research Article

Research in Plant Disease 2025;31(2):131-140.

Published online: June 30, 2025

DOI: https://doi.org/10.5423/RPD.2025.31.2.131

Survey of Plant Diseases in Horticultural Crops in Cheorwon, South Korea, in 2024

Miah Bae¹, Namsuk Kim², Sangyeon Ju¹, Byungyeon Kim¹, Hyunmo Gu², MeeKyoung Kim², Mi-Ri Park^1,^*

¹Division of Region-Specific Industries Fostering, Cheorwon Plasma Research Institute, Cheorwon 24047, Korea

²Division of Agricultural Policy, Cheorwon Agricultural Technology Center, Cheorwon 24023, Korea

^*Corresponding author
Tel: +82-33-452-9718 Fax: +82-33-452-5777 E-mail: mrpark@cpri.re.kr

Received April 1, 2025 Accepted April 14, 2025

This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

ABSTRACT

A field survey was conducted from January to October 2024 to investigate the occurrence of plant diseases caused by fungal, bacterial, and viral pathogens in major horticultural crops cultivated in Cheorwon-gun, Gangwon-do, South Korea. Eight representative crops, including paprika and tomato, were examined using specific primers for pathogenic microorganisms via polymerase chain reaction (PCR) and reverse transcription PCR (RT-PCR). As a result, five fungal pathogens were detected: Botrytis cinerea, Fusarium oxysporum, Phytophthora capsici, P. infestans, and Pythium ultimum. Among them, P. ultimum and P. infestans were predominant, each accounting for 40% of the total fungal detections, jointly representing 80.00% of all fungal cases. Three bacterial pathogens were identified: Clavibacter michiganensis, Pectobacterium carotovorum, and Ralstonia solanacearum, with R. solanacearum showing the highest incidence (75%). Seven viral pathogens were also detected, including broad bean wilt virus 2, cucumber green mottle mosaic virus, cucumber mosaic virus, pepper mottle virus, pepper mild mottle virus, tomato spotted wilt virus (TSWV), and watermelon mosaic virus, with TSWV being the most prevalent (64.86%). Spatial analysis showed that R. solanacearum and TSWV were found across all six surveyed regions of Cheorwon-gun, indicating widespread distribution. Seasonal patterns revealed that fungal diseases were most prevalent in May, bacterial diseases peaked during July and August, and viral infections were primarily detected between May and July. These findings provide baseline data for the development of effective disease monitoring and management strategies in horticultural crop production in Cheorwon-gun.

Keywords: Cheorwon-gun, Disease management, Field survey, Horticultural crops, Plant pathogens

Introduction

Major diseases in horticultural crops caused by plant pathogens include fungal and bacterial infections such as gray mold (Botrytis cinerea), Phytophthora root rot, damping-off, Fusarium wilt, bacterial stem rot, bacterial canker, and bacterial wilt. Viral diseases caused by pathogens such as cucumber mosaic virus (CMV), tomato spotted wilt virus (TSWV), pepper mottle virus (PepMoV), and watermelon mosaic virus (WMV) are also of major concern (Kim et al., 2012; Osusky et al., 2005; Sundin et al., 2016). These diseases can result in yield losses ranging from 13% to 22% globally, threatening food security when staple crops are infected, and causing substantial economic losses to growers of high-value horticultural crops (He et al., 2021; Mwangi et al., 2023).

According to a 2018 report by Statistics Korea, rising temperatures due to global warming have shifted the primary cultivation areas of many crops northward, from southern provinces to regions like Chungcheongbuk-do and Gangwon-do. This geographic shift may also lead to the northward expansion of plant pathogens originally prevalent in southern regions (Bebber et al., 2013; Chaloner et al., 2021). As climate change directly impacts not only cultivated crops but also the distribution and activity of their pathogens, it is essential to assess the current status of plant disease incidence and develop preemptive management strategies (Cohen and Leach, 2020; Richard et al., 2022).

In this study, we focused on crops cultivated in Cheorwon-gun and selected key pathogens based on pest and disease information provided by the Rural Development Administration of Korea. The targeted pathogens included seven fungal species (Alternaria solani, B. cinerea, Fusarium oxysporum, Sclerotinia sclerotiorum, Phytophthora capsici, Phytophthora infestans, and Pythium ultimum), three bacterial species (Clavibacter michiganensis, Pectobacterium carotovorum, and Ralstonia solanacearum), and seven viruses (road bean wilt virus 2 [BBWV2], cucumber green mottle mosaic virus [CGMMV], CMV, PepMoV, pepper mild mottle virus [PMMoV], TSWV, and WMV). Polymerase chain reaction (PCR) and reverse transcription PCR (RT-PCR) assays were performed for molecular diagnosis of these pathogens.

The objectives of this study were to conduct a field survey from January to October 2024 to identify fungal, bacterial, and viral pathogens in major horticultural crops grown in Cheorwon, analyze their distribution and seasonal occurrence, and provide foundational data to facilitate early diagnosis and timely management of plant diseases in the region.

Materials and Methods

Survey area and sample collection.

A field survey was conducted from January to October 2024 across six administrative districts of Cheorwon-gun: Galmal-eup, Geunnam-myeon, Gimhwa-eup, Dongsong-eup, Seo-myeon, and Cheorwon-eup. In collaboration with the Cheorwon Agricultural Technology Center, symptomatic samples were collected from eight major horticultural crops cultivated in the region, including paprika, tomato, chili pepper, green pepper, cucumber, zucchini squash, melon, and mini watermelon. A total of 177 plant samples exhibiting disease symptoms were collected and subjected to molecular analysis (Fig. 1A).

Fig. 1.

Overview of plant disease occurrence by region, pathogen type, and dominant species detected in horticultural crops of Cheorwon-gun. (A) Regional distribution and infection status of surveyed farms in Cheorwon-gun; (B) number of farms with fungal, bacterial, and viral diseases, including co-infected cases; and (C) distribution of detected fungi, bacteria, and viruses in positive farms. BBWV2, broad bean wilt virus 2; CGMMV, cucumber green mottle mosaic virus; CMV, cucumber mosaic virus; PepMoV, pepper mottle virus; PMMoV, pepper mild mottle virus; TSWV, tomato spotted wilt virus; WMV, watermelon mosaic virus.

PCR detection of fungal and bacterial pathogens.

For the diagnosis of fungal and bacterial diseases, PCR was performed targeting seven fungal pathogens (A. solani, B. cinerea, F. oxysporum, S. sclerotiorum, P. capsici, P. infestans, and P. ultimum) and three bacterial pathogens (C. michiganensis, P. carotovorum, and R. solanacearum). DNA was extracted from the symptomatic plant tissues using the Biocube Extraction Kit (Biocubesystem, Suwon, Korea) according to the manufacturer's protocol. The template DNA was absorbed into a porous ceramic Biocube prior to amplification.

Each 20 µl PCR reaction contained 10 µl of 2X PCR master mix, 1 µl each of forward and reverse primers (10 pmol), and 8 µl of distilled water. One Biocube was placed into each reaction tube. PCR cycling conditions were as follows: initial denaturation at 95°C for 5 min; 35 cycles of denaturation at 95°C for 30 sec, annealing at 55-65°C for 30 sec (depending on primer), and extension at 72°C for 1 min; and a final extension at 72°C for 5 min. Primer sequences and specific reaction conditions are summarized in Table 1.

Table 1.

Primer sequences and PCR/RT-PCR conditions for detection of fungal, bacterial, and viral pathogens

	Pathgen	Primer	Sequence (5’→3’)	Annealing temp. (^°C)	Amplicon size (bp)	Reference
Fungal diseases	Alternaria solani	ITS5	GGAAGTAAAAGTCGTAACAAGG	56	460	Kokaeva et al. (2018)
		SR	CTTGGGGCTGGAAGAGAGCGC			Kokaeva et al. (2018)
	Botrytis cinerea	BTNF1	GCTTGACCCAGGCTTGAAC	65	112	Song et al. (2008)
		BTNR1	TGGGTCTGGTCCCGTGTAA			Song et al. (2008)
	Fusarium oxysporum	uni-f	ATCATCTTGTGCCAACTTCAG	61	670-672	Çolak and Biçici (2013)
		uni-r	GTTTGTGATCTTTGAGTTGCCA			Çolak and Biçici (2013)
	Sclerotinia sclerotiorum	IGS2F	TTACAAAGATCCTCTTTCCATTCT	56	834	Clarkson et al. (2017)
		IGS2R	GCCTTTACAGGCTGACTCTTC			Clarkson et al. (2017)
	Phytophthora capsici	Pc1F	GTATAGCAGAGGTTTAGTGAA	56	364	Lan et al. (2013)
		Pc1R	ACTGAAGTTCTGCGTGCGTT			Lan et al. (2013)
	Phytophthora infestans	PINF	CTCGCTACAATAGGAGGGTC	55	Approxi-mately 600	Wangsomboondee and Ristaino (2002)
		ITS5	GGAAGTAAAAGTCGTAACAAGG		Approxi-mately 600	Wangsomboondee and Ristaino (2002)
	Pythium ultimum	AFP276	TGTATGGAGACGCTGCATT	58	150	Lievens et al. (2006)
		ITS4	TCCTCCGCTTATTGATATGC			Lievens et al. (2006)
Bacterial diseases	Clavibacter michiganensis	CmmF	ACCCTTTCCGTCGTCCTGTTGT	66	165	Park et al. (2018)
		CmmR	ATCGTTTCGCCTCCCCGAAG			Park et al. (2018)
	Pectobacterium carotovorum	EXPCCR	GCCGTAATTGCCTACCTGCTTAAG	60	566	Kang et al. (2003)
		EXPCCF	GAACTTCGCACCGCCGACCTTCTA			Kang et al. (2003)
	Ralstonia solanacearum	759 F	GTCGCCGTCAACTCACTTTCC	62	690	Lee et al. (2013)
		760 R	GTCGCCGTCAGCAATGCGGAATCG			Lee et al. (2013)
Viral diseases	Broad bean wilt virus 2	BBWV2 F1	AATGAAGTGGTGCTCAACTACACA	60	654	Cho et al. (2011)
	(BBWV)	BBWV2 R1	TTTTGGAGCATTCAACCATTTGGA			Cho et al. (2011)
	Cucumber mosaic virus	CMV Fny-F	ATGGACAAATCTGAATCAAC	54	655	Kil et al. (2018)
	(CMV)	CMV Fny-R	AGACTGGGAGCACTCCAG			Kil et al. (2018)
	Pepper mottle virus	PepMoV F2	AATGGCACGTCCCCAAA	56	705	Won et al. (2019)
	(PepMoV)	PepMoV R2	TCTCTCTCATGCCAACTACGA			Won et al. (2019)
	Pepper mild mottle virus	PMMoV F1	ACAGTTTCCAGTGCCAATCA	56	310	Lee and Ryu (2016)
	(PMMoV)	PMMoV R1	AAGCGTCTCGGCAGTTG			Lee and Ryu (2016)
	Tomato spotted wilt virus	TSWV CP-F	GAGATTCTCAGAATTCCCAGT	54	495	Kim et al. (2018)
	(TSWV)	TSWV CP-R	AGAGCAATCGTGTCAATTTTATTC			Kim et al. (2018)
	Cucumber green mottle mosaic	CGMMV F2	TTATTGCGTTTAGTGCTTCTTATG	55	417	Lee et al. (2004)
	virus (CGMMV)	CGMMV R2	AAAACGCGGCTTCAAATG			Lee et al. (2004)
	Watermelon mosaic virus	WMV-CP-F	GTGGATCGTTTAAAACAGGAATG	54	178
	(WMV)	WMV-CP-R	GTGACTGAGCATTCATAAAGCAC

PCR, polymerase chain reaction; RT-PCR, reverse transcription PCR; temp., temperature.

RT-PCR detection of viral pathogens.

Seven RNA viruses (BBWV2, CMV, PepMoV, PMMoV, TSWV, CGMMV, and WMV) were detected using RT-PCR. Total RNA was extracted using the Biocube Extraction Kit and prepared following the same Biocube-based protocol as for DNA extraction. Each 20 µl RT-PCR reaction consisted of 10 µl of BCS RT-PCR 2X master mix (for virus detection), 1 µl each of forward and reverse primers (10 pmol), and 8 µl of distilled water. Reverse transcription was carried out at 48°C for 5 min, followed by PCR amplification using the same cycling protocol as for DNA templates. Specific primers used for each viral target are listed in Table 1.

Results and Discussion

Disease incidence by region and crop.

Between January and October 2024, plant pathogenic microorganisms were detected in 52 of the 86 surveyed farms (60.47%) across Cheorwon-gun. Pathogen detection was highest in Geunnam-myeon (13 out of 24 farms) and Dongsong-eup (14 out of 23 farms). Other regions such as Gimhwa-eup (9 out of 13), Seo-myeon (8 out of 13), Galmal-eup (6 out of 11), and Cheorwon-eup (2 out of 2) also reported positive detections (Fig. 1A).

Among pathogen categories, bacterial diseases were most prevalent, detected in 24 farms, followed by fungal diseases in 22 farms and viral infections in 17 farms. Mixed infections were also observed: six farms had co-infection with fungi and bacteria, four farms with fungi and viruses, and one farm with both bacteria and viruses (Fig. 1B).

Crop-wise, fungal diseases were most frequently detected in paprika, bacterial diseases were most common in tomato, and viral infections were primarily found in chili pepper. This trend reflects both host susceptibility and potential environmental and cultivation-related factors influencing pathogen dynamics (Table 2).

Table 2.

Crop-wise occurrence of fungal, bacterial, and viral pathogens in Cheorwon-gun

Crops	Detected farms				Undetected farms	Total number of farms
Crops	Fungal diseases	Bacterial diseases	Viral diseases	Total	Undetected farms	Total number of farms
Paprika	12	8	6	23	9	32
Tomato	6	11	3	16	13	29
Chili pepper	3	3	7	10	7	17
Green pepper	1	2	0	2	1	3
Zucchini squash	0	0	1	1	0	1
Cucumber	0	0	0	0	1	1
Melon	0	0	0	0	2	2
Mini watermelon	0	0	0	0	1	1
Total	22	24	17	52	34	86

The most dominant fungal pathogens detected were P. infestans and P. ultimum, while R. solanacearum was the predominant bacterial species, and TSWV was the most frequently detected virus (Fig. 1C). In cases where plant disease symptoms were present but no pathogenic organism was detected, potential causes included abiotic stress such as over-irrigation, fertilizer or chemical misuse, or insect damage caused by small root-feeding gnats or fungus gnats.

Occurrence of fungal diseases.

Fungal pathogens were detected using species-specific PCR targeting seven common soil- and air-borne fungi. P. infestans and P. ultimum were the predominant species, each accounting for 40% of total fungal detections, and primarily associated with paprika, tomato, and chili pepper crops (Table 3). F. oxysporum and P. capsici were each detected at 8.57%, and B. cinerea was identified in 2.86% of fungal cases. A. solani and S. sclerotiorum were not detected in any sample during the survey period.

Table 3.

Pathogen detection frequency by classification and host crop

Pathogen	Paprika	Tomato	Chili pepper	Green pepper	Zucchini squash	Cucumber	Melon	Mini watermelon	Total	Detection rate (%)
Fungal disease
A. solani	0	0	0	0	0	0	0	0	0	0.00
B. cinerea	0	0	0	1	0	0	0	0	1	2.86
F. oxysporum	3	0	0	0	0	0	0	0	3	8.57
P. capsici	1	2	0	0	0	0	0	0	3	8.57
P. infestans	6	4	4	0	0	0	0	0	14	40.00
P. ultimum	9	4	1	0	0	0	0	0	14	40.00
S. sclerotiorum	0	0	0	0	0	0	0	0	0	0.00
Total	19	10	5	1	0	0	0	0	35	100.00
Bacterial disease
C. michiganensis	4	2	0	1	0	0	0	0	7	19.44
P. carotovorum	0	1	1	0	0	0	0	0	2	5.56
R. solanacearum	6	16	3	2	0	0	0	0	27	75.00
Total	10	19	4	3	0	0	0	0	36	100.00
Viral disease
BBWV2	0	0	1	0	0	0	0	0	1	2.70
CGMMV	0	0	0	0	1	0	0	0	1	2.70
CMV	0	0	2	0	2	0	0	0	4	10.81
PepMoV	0	0	2	0	0	0	0	0	2	5.41
PMMoV	1	0	2	0	0	0	0	0	3	8.11
TSWV	7	6	11	0	0	0	0	0	24	64.86
WMV	0	0	0	0	2	0	0	0	2	5.41
Total	8	6	18	0	5	0	0	0	37	100.00

BBWV2, broad bean wilt virus 2; CGMMV, cucumber green mottle mosaic virus; CMV, cucumber mosaic virus; PepMoV, pepper mottle virus; PMMoV, pepper mild mottle virus; TSWV, tomato spotted wilt virus; WMV, watermelon mosaic virus.

Regionally, P. infestans was identified in Galmal-eup, Geun-nam-myeon, Gimhwa-eup, Dongsong-eup, and Seo-myeon, while P. ultimum was detected only in Gimhwa-eup and Geunnam-myeon, both located in the eastern part of Cheorwon-gun (Table 4). In Seo-myeon, four fungal pathogens—B. cinerea, F. oxysporum, P. capsici, and P. infestans—were detected, indicating a higher diversity of fungal diseases in this region. In Gimhwa-eup, F. oxysporum, P. infestans, and P. ultimum were present. Geunnam-myeon yielded P. infestans and P. ultimum, whereas Galmal-eup and Dongsong-eup had only P. infestans detections. No fungal pathogens were detected in Cheorwon-eup.

Table 4.

Regional detection summary of plant pathogens across six districts

	Cheorwon-eup	Dongsong-eup	Galmal-eup	Geunnam-myeon	Gimhwa-eup	Seo-myeon	Total
No. of samples	3	40	17	57	30	30	177
Fungi
A. solani	0	0	0	0	0	0	0
B. cinerea	0	0	0	0	0	1	1
F. oxysporum	0	0	0	0	1	2	3
P. capsici	0	0	0	0	0	3	3
P. infestans	0	3	4	1	1	5	14
P. ultimum	0	0	0	4	10	0	14
S. sclerotiorum	0	0	0	0	0	0	0
No. of infected samples	0	3	4	5	12	11	35
Bacteria
C. michiganensis	0	4	1	0	1	1	7
P. carotovorum	0	1	0	0	0	1	2
R. solanacearum	3	4	4	9	2	5	27
No. of infected samples	3	9	5	9	3	7	36
Virus
BBWV2	1	0	0	0	0	0	1
CGMMV	0	0	0	0	0	1	1
CMV	0	0	0	2	0	2	4
PepMoV	0	0	0	2	0	0	2
PMMoV	2	0	0	1	0	0	3
TSWV	2	7	1	9	2	3	24
WMV	0	0	0	0	0	2	2
No. of infected samples	5	7	1	14	2	8	37

These regional patterns suggest that P. ultimum may be environmentally restricted or associated with specific cultivation practices found in eastern Cheorwon. The co-occurrence of P. ultimum and P. infestans in crops such as paprika and tomato is concerning, given their potential to spread through wind, irrigation water, and soil. This underscores the need for targeted monitoring and management of P. ultimum in high-risk areas.

Compared to 2023, when F. oxysporum-induced damping-off caused severe economic losses in paprika farms due to seed-borne infections, its reduced prevalence in 2024 suggests improved seed hygiene and management practices. Meanwhile, P. ultimum and P. infestans have emerged as the major fungal threats in the region (Bae et al., 2024). Continued monitoring and region-specific disease control strategies are recommended to prevent future outbreaks.

Occurrence of bacterial diseases.

To investigate the prevalence of bacterial diseases in Cheorwon, PCR diag-nostics targeting C. michiganensis, P. carotovorum, and R. solanacearum were conducted on symptomatic samples collected from January to October 2024 (Tables 3, 4).

Among these, R. solanacearum was the most frequently detected, accounting for 75% of total bacterial detections. This pathogen was found across all six surveyed regions— Cheorwon-eup, Dongsong-eup, Galmal-eup, Geunnam-myeon, Gimhwa-eup, and Seo-myeon—indicating its widespread distribution and strong adaptability to various field conditions. It was detected in a range of crops, including paprika, tomato, chili pepper, and green pepper.

C. michiganensis was the second most prevalent bacterial pathogen (19.44%), detected primarily in tomato, paprika, and green pepper, while P. carotovorum was the least detected (5.56%), found in chili pepper and tomato samples. Notably, C. michiganensis, P. carotovorum and R. solanacearum were all identified in Dongsong-eup and Seo-myeon, suggesting potential hotspots for bacterial disease diversity. In Galmal-eup and Gimhwa-eup, only C. michiganensis and R. solanacearum were detected, while Cheorwon-eup and Geun-nam-myeon exclusively reported R. solanacearum infections.

The dominance of R. solanacearum aligns with its known epidemiological behavior, thriving in high-temperature and high-humidity environments, particularly during the summer season. Its persistence in soil and irrigation water highlights the importance of long-term field sanitation and water management practices. Early detection systems and resistant cultivars should be prioritized in managing this pathogen in Cheorwon.

Occurrence of viral diseases.

Viral pathogens were detected in 17 farms through RT-PCR analysis targeting seven common viruses (BBWV2, CGMMV, CMV, PepMoV, PMMoV, TSWV, and WMV). Among these, TSWV was by far the most prevalent, accounting for 64.86% of viral detections and observed in all six regions of Cheorwon-gun. It was primarily found in paprika, tomato, and chili pepper crops, and its widespread occurrence underscores its adaptability and potential for vector-mediated dissemination (Tables 3, 4).

CMV followed with 10.81% of detections, mainly in chili pepper and zucchini squash. PMMoV, PepMoV, and WMV were detected at 8.11%, 5.41%, and 5.41%, respectively. BBWV2 and CGMMV were the least detected, each accounting for 2.70% of cases (Table 3). Regionally, Geunnam-myeon and Seo-myeon each had four virus detections, including CMV, PepMoV, PMMoV, and TSWV in Geunnam-myeon and CGMMV, CMV, TSWV, and WMV in Seo-myeon. Cheorwon-eup reported BBWV2, PMMoV, and TSWV, while Gimhwa-eup, Galmal-eup, and Dongsong-eup only showed TSWV.

Comparison with a previous survey conducted in 2016 showed consistent detection of TSWV across all regions (Kil et al., 2018). However, CMV incidence has declined, now only appearing in Geunnam-myeon and Seo-myeon, whereas PepMoV, previously undetected, newly emerged in Geun-nam-myeon in 2024. These changes may reflect shifts in vector populations or environmental conditions influencing virus spread.

TSWV was first detected in May, coinciding with the start of thrips activity, and peaked in July when multiple viruses were also found. This seasonal pattern indicates the importance of early vector control to prevent virus establishment and spread in susceptible crops.

Temporal trends and mixed infections.

To evaluate seasonal patterns and co-infection trends, plant disease incidence data from January to October 2024 were analyzed. Fungal pathogens were primarily detected between March and May, peaking in May before declining as temperatures increased. Bacterial pathogens were most prevalent in July and August, coinciding with the hottest and most humid period of the year. Viral pathogens showed the highest detection rates between May and July. Notably, TSWV began appearing in May, aligned with the onset of thrips activity, and a variety of viruses were co-detected in July (Fig. 2).

Fig. 2.

Seasonal detection trends of fungal, bacterial, and viral pathogens in Cheorwon-gun during 2024. (A) Monthly trend of overall plant pathogen detections from January to October 2024 and (B) monthly occurrence patterns of fungal, bacterial, and viral pathogens. BBWV2, broad bean wilt virus 2; CGMMV, cucumber green mottle mosaic virus; CMV, cucumber mosaic virus; PepMoV, pepper mottle virus; PMMoV, pepper mild mottle virus; TSWV, tomato spotted wilt virus; WMV, watermelon mosaic virus.

Mixed infections were found in 16 farms. These included fungal-fungal co-infections (e.g., F. oxysporum + P. infestans), bacterial-bacterial co-infections (C. michiganensis + R. solanacearum), and viral co-infections (e.g., CMV + PepMoV, CMV + CGMMV + WMV). All viral co-infections involved aphid-transmitted viruses, suggesting shared vector path-ways (Fang et al., 2021; Gildow et al., 2008; Moya-Ruiz et al., 2023; Qi et al., 2021) (Table 5).

Table 5.

Summary of mixed infections by pathogen type and combination

Combination	No. of farms	No. of detection	Complex detection pathogens
Fungi + fungi	1	1	F. oxysporum + P. infestans
Bacteria + bacteria	2	2	C. michiganensis + R. solanacearum
		1	CMV + PepMoV
Virus + virus	2	1	CMV + CGMMV + WMV
		1	P. capsici + R. solanacearum
		2	P. infestans + R. solanacearum
Fungi + bacteria	6	1	P. infestans + C. michiganensis + R. solanacearum
		1	B. cinerea + C. michiganensis + R. solanacearum
		1	P. capsici + P. infestans + P. carotovorum + R. solanacearum
		1	P. infestans + TSWV
Fungi + virus	4	2	P. ultimum + TSWV
		1	P. infestans + P. ultimum + TSWV
Bacteria + virus	1	1	R. solanacearum + BBWV2 + PMMoV + TSWV
Fungi + bacteria + virus	0

CMV, cucumber mosaic virus; PepMoV, pepper mottle virus; CGMMV, cucumber green mottle mosaic virus; WMV, watermelon mosaic virus; TSWV, tomato spotted wilt virus.

The most frequent co-infections occurred between fungal and bacterial pathogens (6 farms), all involving R. solanacearum, primarily with P. capsici or P. infestans. Four fungus-virus co-infections were detected, all involving TSWV along with either P. infestans or P. ultimum. One farm showed a bacterial-virus co-infection including R. solanacearum, BBWV2, PMMoV, and TSWV. No triple co-infections (fungus-bacterium-virus) were observed.

These findings highlight the need to monitor overlapping environmental conditions, pathogen ecology, and vector activity in order to prevent co-infection-driven disease outbreaks. We recommend integrating disease surveillance and control strategies will be critical to mitigate risks in horticultural crop systems.

This study provides a comprehensive overview of plant pathogen occurrence in major horticultural crops across Cheorwon-gun, South Korea, from January to October 2024. Among the 86 farms surveyed, 60.47% tested positive for at least one fungal, bacterial, or viral pathogen. The most frequently detected pathogens were P. ultimum and P. infestans among fungal species, R. solanacearum among bacteria, and TSWV among viruses.

Temporal analysis revealed that fungal pathogens peaked in spring (May), bacterial pathogens during the summer monsoon season (July to August), and viral infections during late spring to early summer (May to July), particularly associated with vector activity. Spatially, R. solanacearum and TSWV were identified in all six surveyed districts, indicating widespread endemicity. Mixed infections, particularly between fungi and bacteria, were frequently observed and may exacerbate disease severity in crops.

These findings emphasize the importance of early diagnosis and proactive management strategies tailored to local climate and cropping conditions. Disease surveillance and integrated pest and disease control systems should consider seasonal pathogen dynamics, co-infection patterns, and regional disease hotspots to minimize economic loss and ensure sustainable horticultural production in Cheorwon-gun.

NOTES

Conflicts of Interest

No potential conflict of interest relevant to this article was reported.

Acknowledgments

This research was supported by Cheorwon Agricultural Technology Center.

REFERENCES

Bae, M., Kim, N., Kim, S. W., Ju, S., Kim, B., Hwang, S. M. et al. 2024. Paprika damping-off outbreak caused by Fusarium oxysporum contaminated seeds in Cheorwon province in 2023. Res. Plant Dis. 30: 26-33. (In Korean)

Bebber, D. P., Ramotowski, M. A. and Gurr, S. J. 2013. Crop pests and pathogens move polewards in a warming world. Nat. Clim. Change. 3: 985-988.

Chaloner, T. M., Gurr, S. J. and Bebber, D. P. 2021. Plant pathogen infection risk tracks global crop yields under climate change. Nat. Clim. Change. 11: 710-715.

Cho, J.-D., Lee, J.-H., Ko, S.-J., Choi, H.-S., Lee, S.-H., Choi, G.-S. et al. 2011. Symptoms of cucumber virus diseases occurred in Sangju and Gurye in 2006 and 2007. Res. Plant Dis. 17: 196-204. (In Korean)

Clarkson, J. P., Warmington, R. J., Walley, P. G., Denton-Giles, M., Barbetti, M. J., Brodal, G. et al. 2017. Population structure of Sclerotinia subarctica and Sclerotinia sclerotiorum in England, Scotland and Norway. Front. Microbiol. 8: 490.

Cohen, S. P. and Leach, J. E. 2020. High temperature-induced plant disease susceptibility: more than the sum of its parts. Curr. Opin. Plant Biol. 56: 235-241.

Çolak, A. and Biçici, M. 2013. PCR detection of Fusarium oxysporum f. sp. radicis-lycopersici and races of F. oxysporum f. sp. lycopersici of tomato in protected tomato-growing areas of the eastern Mediterranean region of Turkey. Turk. J. Agric. For. 37: 457-467.

Fang, M., Yu, J. and Kim, K.-H. 2021. Pepper mottle virus and its host interactions: current state of knowledge. Viruses 13: 1930.

Gildow, F. E., Shah, D. A., Sackett, W. M., Butzler, T., Nault, B. A. and Fleischer, S. J. 2008. Transmission efficiency of cucumber mosaic virus by aphids associated with virus epidemics in snap bean. Phytopathology 98: 1233-1241.

He, D. C., He, M. H., Amalin, D. M., Liu, W., Alvindia, D. G. and Zhan, J. 2021. Biological control of plant diseases: an evolutionary and eco-economic consideration. Pathogens 10: 1311.

Kang, H. W., Kwon, S. W. and Go, S. J. 2003. PCR‐ based specific and sensitive detection of Pectobacterium carotovorum ssp. carotovorum by primers generated from a URP‐ PCR fingerprinting‐ derived polymorphic band. Plant Pathol. 52: 127-133.

Kil, H. B., Kang, M., Choi, W.-S., Kim, J.-I., Phan, M. S. V., Im, J. H. et al. 2018. Survey of the routes and incidence of viral infection of tomato and paprika growing in greenhouses in Cherwon province, Korea during 2015-2017. Res. Plant Dis. 24: 145-152. (In Korean)

Kim, J.-S., Lee, S.-H., Choi, H.-S., Kim, M.-K., Kwak, H.-R., Kim, J.-S. et al. 2012. 2007-2011 characteristics of plant virus infections on crop samples submitted from agricultural places. Res. Plant Dis. 18: 277-289. (In Korean)

Kim, M., Kim, J. E., Kim, J., Kwak, H. R., Choi, H. S., Lee, H. J. et al. 2018. First report of tomato spotted wilt virus in Hoya carnosa in Korea. Plant Dis. 102: 1672.

Kokaeva, L. Y., Belosokhov, A. F., Doeva, L. Y., Skolotneva, E. S. and Elansky, S. N. 2018. Distribution of Alternaria species on blight-ed potato and tomato leaves in Russia. J. Plant Dis. Protect. 125: 205-212.

Lan, C. Z., Liu, P. Q., Li, B. J., Chen, Q. H. and Weng, Q. Y. 2013. Development of a specific PCR assay for the rapid and sensitive detection of Phytophthora capsici. Australas. Plant Pathol. 42: 379-384.

Lee, G. H. and Ryu, C.-M. 2016. Spraying of leaf-colonizing Bacillus amyloliquefaciens protects pepper from cucumber mosaic virus. Plant Dis. 100: 2099-2105.

Lee, S. K., Song, W. Y. and Kim, H. M. 2004. Detection of cucumber green mottle mosaic virus in bottle gourd seeds by RT-PCR. Res. Plant Dis. 10: 53-57. (In Korean)

Lee, Y. K. and Kang, H. W. 2013. Physiological, biochemical and genetic characteristics of Ralstonia solanacearum strains isolated from pepper plants in Korea. Res. Plant Dis. 19: 265-272. (In Korean)

Lievens, B., Brouwer, M., Vanachter, A. C., Cammue, B. P. and Thomma, B. P. 2006. Real-time PCR for detection and quantification of fungal and oomycete tomato pathogens in plant and soil samples. Plant Sci. 171: 155-165.

Moya-Ruiz, C., Gómez, P. and Juárez, M. 2023. Occurrence, distribution, and management of aphid-transmitted viruses in cucur-bits in Spain. Pathogens 12: 422.

Mwangi, R. W., Mustafa, M., Charles, K., Wagara, I. W. and Kappel, N. 2023. Selected emerging and reemerging plant pathogens affecting the food basket: a threat to food security. J. Agric. Food Res. 14: 100827.

Osusky, M., Osuska, L., Kay, W. and Misra, S. 2005. Genetic modification of potato against microbial diseases: in vitro and in planta activity of a dermaseptin B1 derivative, MsrA2. Theor. Appl. Genet. 111: 711-722.

Park, M.-J., Back, C.-G. and Park, J.-H. 2018. PCR detection method for rapid diagnosis of Bacterial canker caused by Clavibacter michiganensis on tomato. Res. Plant Dis. 24: 342-347. (In Korean)

Qi, Y.-H., He, Y.-J., Wang, X., Zhang, C.-X., Chen, J.-P., Lu, G. et al. 2021. Physical contact transmission of cucumber green mottle mosaic virus by Myzus persicae. PLoS One 16: e0252856.

Richard, B., Qi, A. and Fitt, B. D. 2022. Control of crop diseases through integrated crop management to deliver climate‐ smart farming systems for low‐ and high‐ input crop production. Plant Pathol. 71: 187-206.

Song, J. Y., Lim, J. H., Nam, M. H., Kim, H. G. and Kim, B.-S. 2008. Development of PCR primers for specific identification and detection of Botrytis cinerea on tomato. Kor. J. Mycol. 36: 138-143. (In Korean)

Sundin, G. W., Castiblanco, L. F., Yuan, X., Zeng, Q. and Yang, C. H. 2016. Bacterial disease management: challenges, experience, innovation and future prospects: challenges in bacterial molecular plant pathology. Mol. Plant Pathol. 17: 1506-1518.

Wangsomboondee, T. and Ristaino, J. B. 2002. Optimization of sample size and DNA extraction methods to improve PCR detection of different propagules of Phytophthora infestans. Plant Dis. 86: 247-253.

Won, H.-S., Park, D.-K., Kwon, S.-B., Jo, S.-O., Kang, S.-H., Lee, J.-H. et al. 2019. Incidence of viral diseases on solanaceae crops in Gangwon province. Res. Plant Dis. 25: 22-28. (In Korean)