Alternaria alternata에 의한 동백나무 잎점무늬병 국내 발생 보고

First Report of Leaf Spot on Camellia japonica Caused by Alternaria alternata in Korea

Article information

Res. Plant Dis. 2025;31(1):118-123

Publication date (electronic) : 2025 March 31

doi : https://doi.org/10.5423/RPD.2025.31.1.118

Sunmin An ¹^,²^,^†

, Miju Jo ¹^,²^,^†

, Sook-Young Park ¹^,²^,

¹ Department of Plant Medicine, Sunchon National University, Suncheon 57922, Korea

² Interdisciplinary Program in IT-Bio Convergence System (BK21 plus), Sunchon National University, Suncheon 57922, Korea

안선민¹^,²^,^†

, 조미주¹^,²^,^†

, 박숙영¹^,²^,

¹ 순천대학교 식물의학과

² 순천대학교 IT-Bio 융합시스템(BK21 plus) 협동과정

^∗ Corresponding author Tel: +82-61-750-5187 Fax: +82-61-750-5187 E-mail: spark@scnu.ac.kr

†These authors equally contributed.

Received 2025 March 4; Accepted 2025 March 12; Revised 2025 March 13.

Abstract

2023년 5월 전남 순천시의 동백나무 (Camellia japonica) 잎에서 점무늬병이 관찰되었다. 원인 병원균을 동정하기 위해 병징이 나타난 잎에서 병원균을 분리하였다. 형태적 특성과 계통학적 분석을 통해 원인 병원균이 Alternaria alternata로 밝혀졌다. 병원성 검정을 통해 A. alternata가 원인 병원균임을 확인하였으며, 감염된 잎에서 동일한 병원균을 재분리하여 Koch의 법칙을 충족하였다. 이 연구는 우리나라에서 C. japonica의 잎점무늬병 원인 병원균이 A. alternata임을 보고한 첫 번째 사례이다. 이 결과는 앞으로 동백나무 잎점무늬병에 대한 효과적인 방제 전략 개발에 기여할 것이다.

Trans Abstract

In May 2023, leaf spot disease was observed on the leaves of camellia trees (Camellia japonica) in Suncheon-si, Jeonnam Province. To identify the fungal species responsible for the disease, we isolated samples from the diseased leaves. Based on morphological characteristics and phylogenetic analysis, we identified the causal fungus of leaf spot disease as the ascomycete Alternaria alternata. Pathogenicity assays confirmed that the isolates were the causal agents of leaf spot disease, and the fungus was reisolated from the infected leaves, thus fulfilling Koch's postulates. To our knowledge, this is the first report of A. alternata as the causal pathogen of leaf spot disease on C. japonica in Korea. Our results will contribute to the development of effective control strategies for this disease in the future.

Keywords: Alternaria alternata; Camellia japonica; Leaf spot

동백나무 (Camellia japonica)는 차나무과 동백나무속에 속하는 쌍떡잎 여러해살이 식물로, 원산지는 중국이며 한국, 일본을 포함한 동아시아에 주로 분포하고 있다(Abe 등, 2024). 동백나무는 10월 초부터 다음 해 4월까지 붉은색, 분홍색, 흰색의 꽃을 피우며, 열매는 세 쪽의 검은색 씨가 들어 있다. 다양한 품종이 개발되어 주로 관상용으로 재배되며 꽃은 차로, 열매는 기름을 추출하여 약용으로 이용되고 있다(Lee 등, 2011).

2023년 5월, 전남 순천시 순천만국가정원(34.92970° N, 127.50955° E)에 식재된 동백나무의 잎에서 점무늬 병징이 전체 잎의 약 10-15%에서 관찰되었다(Fig. 1A). 잎 점무늬 병반의 크기는 직경 1 mm에서 8 mm까지 다양하였으며, 시간이 지날수록 점무늬가 점차 확대되었다(Fig. 1A). 원인 병원균을 구명하기 위해 점무늬 병징에서 병원균을 분리하였다. 먼저 감염된 잎을 5×5 mm 크기로 잘라 70% 에탄올과 1% 차아염소산나트륨(NaClO)으로 각각 1분간 소독한 후, 멸균수로 3회 세척하였다. 이후, 100 µg/ml 농도의 streptomycin을 포함한 1% 물 한천 배지에 치상하여 25 ^o C에서 3-5일간 배양하였다. 자라난 균사는 8% V8 juice agar 배지(Campbell's V8 juice 80 ml, 한천 15 g, 증류수 1 l, 0.1N NaOH로 pH 7.0으로 조정)에 배양하여 단포자 분리를 통해 총 5개의 균주(SYP-1495, SYP-1496, SYP-1497, SYP-1498, SYP-1499)를 순수 분리하였다.

Fig. 1.

Naturally occurring leaf spot symptom on Camellia japonica and morphological characteristics of Alternaria alternata. (A) Leaf spot symptoms on leaves of Camellia japonica. The red arrowheads indicate the leaf spot symptoms. The symptom observed in the lower right quadrant is an enlargement of the white circle shown in the photograph. The front (B) and reverse (C) side of a 10-day-old colony on potato carrot agar medium. (D) Conidia of SYP-1495 on V8 medium. (E) Conidial chain of SYP-1495 on KCl medium at 25 ^o C for 3 days.

형태학적인 특징을 관찰하기 위해, 분리한 병원균의 균총과 포자를 감자 당근 한천 배지(감자 20 g, 당근 20 g, 한천 15 g; 증류수 1 l)에서 25 ^o C에서 10일간 암상태로 배양하였다. 분리한 병원균의 균총은 중앙 부위가 어두운 회색을 띠었으며, 말단 부위 방향으로 점차 밝은 회갈색에서 흰색을 나타냈다(Fig. 1B, C). 포자는 갈색 또는 황갈색으로, 격벽이 있는 곤봉형 또는 타원형이었으며, 가로 격벽은 1-5개, 세로 격벽은 0-2개였다(Fig. 1D, E). KCl 한천 배지(KCl 6 g, 한천 15 g, 증류수, 1 l)에 배양하였을 때, 균사로부터 분생포자경이 발생하여 4-6개의 포자 사슬이 관찰되었다(Fig. 1E). 병원균의 포자 크기는 13.5-37.5×5.4-14.0 µm (평균 22.9×5.1 µm, n=100)로 측정되었다. 이러한 형태학적인 특성은 Alternaria spp.의 형태학적인 특성과 일치하였다(Woudenberg 등, 2013, 2014, 2015).

형태학적으로 Alternaria 속으로 동정된 병원균의 분자생물학적 동정을 위해 ribosomal RNA의 small subunit (SSU), large subunit (LSU) internal transcribed spacer region (ITS), glyceraldehyde-3-phosphate dehydrogenase (gapdh), translation elongation factor 1-alpha (tef1), RNA polymerase second largest subunit (rpb2), Alternaria major allergen gene 1 (Alt a 1), endopolygalacturonase (endoPG), anonymous gene region (OPA10-2)을 포함한 총 9개 Alternaria의 종 동정을 위한 분자 마커 유전자를 증폭할 수 있는 프라이머 정보(Table 1)를 활용하여 본 연구에서 분리한 5개 균주로부터 중합효소 연쇄 반응(polymerase chain reaction, PCR) 증폭 산물을 확보하였다.

Table 1.

Primers used for PCR and sequencing

PCR 증폭 산물의 염기서열은 바이오니아(Bioneer Inc., Dae-jeon, Korea)의 염기서열 분석 서비스를 통해 분석하였다. 확보된 염기서열은 DNAStar (Madison, WI, USA)의 SeqMan 프로그램을 사용하여 양방향의 염기서열을 조립하고 편집하였다. 본 연구에서 확보된 염기서열 정보는 모두 미국 국립생명공학정보센터(National Center for Biotechnology Information [NCBI]; http://www.ncbi.nlm.nih.gov/)에 등록하였다(Table 2).

Table 2.

Strains used in this study and their GenBank accession numbers

확보된 염기서열을 NCBI의 Basic Local Alignment Search Tool에서 검색한 결과, 5개의 순수 분리 균주(SYP-1495~SYP-1499)의 SSU (GenBank accession no. PV172330-PV172334), LSU (PV172335-PV172339), ITS (PV172340-PV172344), gapdh (PV175757-PV175761), tef1 (PV175762-PV175766), rpb2 (PV175767-PV175771), Alt a1 (PV175772-PV175776), endoPG (PV175777-PV175781), OPA10-2 (PV175782-PV175786) 염기서열은 Alternaria alternata CBS 918.96 균주의 염기서열(AF347032, AY278809, KC584693, KC584435, AY563302, KP124026, KP124633)과 각각 100% (1020 bp/1020 bp), 100% (853/853), 100% (519/519), 100% (583/583), 100% (240/240), 100% (830/830), 95.32% (448/470), 99.33% (445/448), 100% (634/634)로 일치하였다. 염기서열 결과를 기반으로 병원균을 잠정적으로 Alternaria alternata로 동정하였다.

염기서열에 기반한 계통분류학적 분석을 위해, GenBank 데이터베이스에서 Alternaria section Alternata (Woudenberg 등, 2015)와 section Porri (Woudenberg 등, 2014)로부터 ex-type strain들 및 대표 균주(representative strain)들로부터 염기서열을 확보한 후, 총 7개의 염기서열 정보(ITS, gapdh, tef1, rpb2, Alt a1, endoPG, OPA10-2)는 Clustal X (Thompson 등, 1997)를 이용하여 다중 염기서열 정렬을 수행하였다. 계통분류학적 분석은 MEGA X 프로그램(https://www.megasoftware.net)을 이용하여 Maximum likelihood 방법으로 진행하였다. 그 결과, 분리된 병원균 SYP-1495~SYP-1499 균주 모두는 A. alternata CBS 918.96(이전 A. tenuissima의 대표 균주)과 묶여 A. alternata임을 다시 한번 확인하였다(Fig. 2A).

Fig. 2.

Phylogenetic analysis and pathogenicity test. (A) A maximum likelihood (ML) tree was constructed using MEGA X. The tree was built using the concatenated sequences of ITS, GAPDH, TEF1, RPB2, Alta, endoPG and OPA10-2 generated from isolates SYP-1495~SYP-1499 as well as the corresponding sequences of Alternaria spp. downloaded from GenBank. Clades containing A. alternata and the present isolates are shaded. Bootstrap value=1,000. The number at each node represents a bootstrap value. Ex-type strains are indicated with T. Representative strains are indicated with R. Mock inoculation (B) without and (C) with wounds. Inoculation of leaves with A. alternata culture block, both without (D) and with (E) wounds, at 7 days post-inoculation. The red arrowheads indicate the site of inoculation.

순수 분리된 균주가 원인 병원균임을 증명하기 위해, 5개의 균주 중 SYP-1495를 대표 균주로 선정하여 병원성 검정을 수행하였다. 접종할 병원균 SYP-1495 균주를 potato dextrose agar (PDA) 배지에서 25 ^o C로 3일간 배양한 후, 직경 5 mm의 코르크볼러를 이용하여 균사 배양체를 준비하였다. 기주 식물인 동백나무의 1년생 가지의 잎에 병원성 검정을 수행하였다. 접종 전 동백나무의 잎과 가지 표면을 70% 에탄올에 3분간 담근 후, 멸균 증류수를 이용하여 표면을 씻고 말린 후 사용하였다. 병원균 접종은 기주 식물에 무상처 접종과 상처 접종으로 나누어 수행하였다. 상처 접종의 경우, 잎 표면에 멸균된 수지침 바늘(0.18×8 mm; Qingdao Dongbang Medical Co., Ltd., Shan-dong, China)을 이용하여 10번 찔러 상처를 낸 뒤, 음성 대조군에는 경우 직경 5 mm의 아무것도 접종하는 않은 PDA 배지를 접종하였고, 실험군에는 직경 5 mm의 SYP-1495 균사 배양체를 접종하였다. 접종 후, 온도는 28 ^o C, 상대 습도 100% 조건에서 2일간 배양한 후 잎 위의 접종원을 제거하였다. 그 후 동일한 조건에서 5일 동안 배양한 뒤 병징을 확인하였다.

음성 대조군에서는 어떠한 병징도 관찰되지 않았으나(Fig. 2B, C), SYP-1495를 무상처 및 상처 접종한 잎에서는 점무늬 병징이 관찰되었다(Fig. 2D, E). 특히, SYP-1495 균주를 상처 접종한 잎의 점무늬 병징은 최초 관찰된 동백나무 점무늬 병징과 매우 유사하였다(Fig. 2D, E). 병징이 나타난 감염 잎으로부터 병원균을 재분리한 후, 단포자를 분리하여 ITS, gapdh, tef1, rpb2, Alt a1, endoPG, OPA10-2 영역을 PCR로 증폭한 결과, SYP-1495 균주의 염기서열과 완벽히 일치하여 Koch의 법칙을 만족하였다.

다범성 병원균인 Alternaria 속은 자낭균(Ascomycetes)에 속하는 식물 곰팡이 병원균으로, 주로 식물의 잎을 가해하는 것으로 알려져 있다(DeMers, 2022). 특히, Alternaria 속 균은 식물 잎에 존재하지만 부생성이 강하여 아무런 병징이 나타나지 않다가, 생장이 적합한 온도(20-30 ^o C)와 높은 상대습도(80% 이상)가 지속될 경우 기생성 병원균으로 변모하여 다양한 병을 일으킨다(Fagodiya 등, 2022). 최근 우리나라에서도 겨울 작물인 보리, 밀, 귀리를 포함한 맥류에서 Alternaria spp.에 의한 병해가 보고되고 있으며(Jeong 등, 2024), 감자에서도 A. alternata 에 의한 잎점무늬병이 보고되었다(Choi 등, 2023). 이는 지금까지 부생균으로 알려진 Alternaria가 기후 변화에 따라 잠재적 주요 병원균이 될 가능성을 시사한다. Alternaria에 의한 동백나무 잎점무늬병의 경우 이탈리아에서는 보고되었으나(Garibaldi 등, 2007), 우리나라에서는 아직 보고된 바가 없다. 따라서, 본 연구는 국내 최초로 A. alternata에 의해 발생한 동백나무 잎점무늬병을 보고하고자 한다. 이 연구는 앞으로 잠재적 문제 병원균인 동백나무 잎점무늬병균 A. alternata 유전자원 확보 및 방제제 개발에 기여할 것이다.

Notes

Conflicts of Interest

No potential conflict of interest relevant to this article was reported.

Acknowledgments

This work was supported by a research promotion program of Sunchon National University (SCNU).

References

Abe H., Ueno S., Matsuo A., Hirota S. K., Miura H., Su M. H., et al. 2024;Evolutionary histories of Camellia japonica and Camellia rusticana . Ecol. Evol. 14:e70721.

Andrew M., Peever T. L., Pryor B. M.. 2009;An expanded multi-locus phylogeny does not resolve morphological species within the small-spored Alternaria species complex. Mycologia 101:95–109.

Berbee M. L., Pirseyedi M., Hubbard S.. 1999; Cochliobolus phylogenetics and the origin of known, highly virulent pathogens, inferred from ITS and glyceraldehyde-3-phosphate dehydrogenase gene sequences. Mycologia 91:964–977.

Carbone I., Kohn L. M.. 1999;A method for designing primer sets for speciation studies in filamentous ascomycetes. Mycologia 91:553–556.

Choi J., Jeong M.-H., Choi E. D., Park J., Park S.-Y.. 2023;First report of brown spot caused by Alternaria alternata on potato (Solanum tuberosom L.) in Korea. Plant Dis. 107:2253.

Crous P. W., Schoch C. L., Hyde K. D., Wood A. R., Gueidan C., de Hoog G. S., et al. 2009;Phylogenetic lineages in the Capnodiales . Stud. Mycol. 64:17–47.

de Hoog G. S., Gerrits van den Ende A. H.. 1998;Molecular diagnostics of clinical strains of filamentous Basidiomycetes. Mycoses 41:183–190.

DeMers M.. 2022; Alternaria alternata as endophyte and pathogen. Microbiology 168:001153.

Fagodiya R. K., Trivedi A., Fagodia B. L.. 2022;Impact of weather parameters on Alternaria leaf spot of soybean incited by Alternaria alternata . Sci. Rep. 12:6131.

Garibaldi A., Gilardi G., Gullino M. L.. 2007;First report of Alternaria leaf spot on Camellia in Italy. Plant Dis. 91:324.

Hong S. G., Cramer R. A., Lawrence C. B., Pryor B. M.. 2005;Alt a 1 allergen homologs from Alternaria and related taxa: analysis of phylogenetic content and secondary structure. Fungal Genet. Biol. 42:119–129.

Jeong M.-H., Choi E. D., Jang S.-H., An S., Jo M., Kim S., et al. 2024;Survey of fungal diseases on barley, wheat, and oats at tillering to stem extension stages in Southern regions of Korea during 2020-2021. Res. Plant Dis. 30:207–218. (In Korean).

Lee H.-H., Cho J.-Y., Moon J.-H., Park K.-H.. 2011;Isolation and identification of antioxidative phenolic acids and flavonoid glycosides from Camellia japonica flowers. Hortic. Environ. Biotechnol. 52:270–277.

Sung G.-H., Sung J.-M., Hywel-Jones N. L., Spatafora J. W.. 2007;A multi-gene phylogeny of Clavicipitaceae (Ascomycota, Fungi): Identification of localized incongruence using a combinational bootstrap approach. Mol. Phylogenet. Evol. 44:1204–1223.

Thompson J. D., Gibson T. J., Plewniak F., Jeanmougin F., Higgins D. G.. 1997;The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res. 25:4876–4882.

Vilgalys R., Hester M.. 1990;Rapid genetic identification and mapping of enzymatically amplified ribosomal DNA from several Cryptococcus species. J. Bacteriol. 172:4238–4246.

White T. J., Bruns T., Lee S., Taylor J.. 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. PCR Protocols: A Guide to Methods and Applications In : Innis M. A., Gelfand D. H., Sninsky J. J., White T. J., eds. p. 315–322. Academic Press. New York, NY, USA:

Woudenberg J. H., Groenewald J. Z., Binder M., Crous P. W.. 2013; Alternaria redefined. Stud. Mycol. 75:171–212.

Woudenberg J. H., Seidl M. F., Groenewald J. Z., de Vries M., Stielow J. B., Thomma B. P., et al. 2015; Alternaria section Alternaria: species, formae speciales or pathotypes? Stud. Mycol. 82:1–21.

Woudenberg J. H., Truter M., Groenewald J. Z., Crous P. W.. 2014;Large-spored Alternaria pathogens in section Porri disen-tangled. Stud. Mycol. 79:1–47.

Article information Continued

This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

Fig. 1.

Table 1.

Primers used for PCR and sequencing

Locus	Primer	Primer sequence (5’-3’)	Reference
SSU	NS1	GTAGTCATATGCTTGTCTC	White et al. (1990)
	NS4	CTTCCGTCAATTCCTTTAAG
LSU	LSU1Fd	GRATCAGGTAGGRATACCCG	Crous et al. (2009)
	LR5	ATCCTGAGGGAAACTTC	Vilgalys and Hester (1990)
ITS	V9G	TTACGTCCCTGCCCTTTGTA	de Hoog and Gerrits van den Ende (1998)
	ITS4	CCTCCGCTTATTGATATGC	White et al. (1990)
gapdh	gpd1	CAACGGCTTCGGTCGCATTG	Berbee et al. (1999)
	gpd2	GCCAAGCAGTTGGTTGTGC
tef1	EF1-728F	CATCGAGAAGTTCGAGAAGG	Carbone and Kohn (1999)
	EF1-986R	TAC TTG AAG GAA CCC TTA CC
rpb2	RPB2-5F2	GGGGWGAYCAGAAGAAGGC	Sung et al. (2007)
	fRPB2-7cR	CCCATRGCTTGTYYRCCCAT
Alt a 1	Alt-For	ATGCAGTTCACCACCATCGC	Hong et al. (2005)
	Alt-Rev	ACGAGGGTGAYGTAGGCGTC
endoPG	PG3	TACCATGGTTCTTTCCGA	Andrew et al. (2009)
	PG2b	GAGAATTCRCARTCRTCYTGRTT
OPA10-2	OPA 10-2R	GATTCGCAGCAGGGAAACTA	Andrew et al. (2009)
	OPA 10-2L	TCGCAGTAAGACACA TTCTACG

PCR, polymerase chain reaction; SSU, small subunit ribosomal RNA; LSU, large subunit ribosomal RNA; ITS, internal transcribed spacer region; gapdh, glyceraldehyde 3-phosphate dehydrogenase; tef1, translation elongation factor 1-alpha; rpb2, RNA polymerase second largest subunit; Alt a 1, Alternaria major allergen gene 1; endoPG, endopolygalacturonase; OPA10-2, anonymous region.

Table 2.

Strains used in this study and their GenBank accession numbers

Name	Strain number	GeneBank accession numbers
Name	Strain number	SSU	LSU	ITS	*gapdh*	*tef1*	*rpb2*	*Alt a1*	*endoPG*	OPA10-2
Alternaria sp.	SYP-1495	PV172330 ^a	PV172335 ^a	PV172340 ^a	PV175757 ^a	PV175762 ^a	PV175767 ^a	PV175772 ^a	PV175777 ^a	PV175782 ^a
	SYP-1496	PV172331 ^a	PV172336 ^a	PV172341 ^a	PV175758 ^a	PV175763 ^a	PV175768 ^a	PV175773 ^a	PV175778 ^a	PV175783 ^a
	SYP-1497	PV172332 ^a	PV172337 ^a	PV172342 ^a	PV175759 ^a	PV175764 ^a	PV175769 ^a	PV175774 ^a	PV175779 ^a	PV175784 ^a
	SYP-1498	PV172333 ^a	PV172338 ^a	PV172343 ^a	PV175760 ^a	PV175765 ^a	PV175770 ^a	PV175775 ^a	PV175780 ^a	PV175785 ^a
	SYP-1499	PV172334 ^a	PV172339 ^a	PV172344 ^a	PV175761 ^a	PV175766 ^a	PV175771 ^a	PV175776 ^a	PV175781 ^a	PV175786 ^a
A. alternata	CBS 102598 ^T	KP124951	KP124481	KP124329	KP124184	KP125105	KP124797	KP123878	KP124031	KP124638
A. alternata	CBS 102600 ^T	KP124953	KP124483	KP124331	KP124186	KP125107	KP124799	KP123880	KP124033	KP124640
A. alternata	CBS 118814 ^T	KP124979	KP124509	KP124357	KP124211	KP125133	KP124825	KP123906	KP124059	KP124669
A. alternata	CBS 916.96 ^T	KC584507	DQ678082	AF347031	AY278808	KC584634	KC584375	AY563301	JQ811978	KP124632
A. alternata	CBS 918.96 ^R	KC584567	KC584311	AF347032	AY278809	KC584693	KC584435	AY563302	KP124026	KP124633
A. alternata	CBS 119543 ^T	KP124985	KP124515	KP124363	KP124215	KP125139	KP124831	KP123911	KP124065	KP124674
A. alternata	CBS 106.24 ^T	KP124919	KP124449	KP124298	KP124155	KP125073	KP124766	KP123847	AY295020	JQ800620
A. alstroemeriae	CBS 118809 ^T	KP124918	KP124448	KP124297	KP124154	KP125072	KP124765	-	KP123994	KP124602
A. alternantherae	CBS 124392	KC584506	KC584251	KC584179	KC584096	KC584633	KC584374	KP123846	-	-
A. arborescens	CBS 102605 ^T	KC584509	KC584253	AF347033	AY278810	KC584636	KC584377	AY563303	AY295028	KP124712
A. betae-kenyensis	CBS 118810 ^T	KP125042	KP124572	KP124419	KP124270	KP125197	KP124888	KP123966	KP124123	KP124733
A. burnsii	CBS 107.38 ^T	KP125043	KP124573	KP124420	JQ646305	KP125198	KP124889	KP123967	KP124124	KP124734
A. eichhorniae	CBS 489.92 ^T	KP125049	KP124579	KC146356	KP124276	KP125204	KP124895	KP123973	KP124130	KP124740
A. gaisen	CBS 118488 ^R	KP125051	KP124581	KP124427	KP124278	KP125206	KP124897	KP123975	KP124132	KP124743
A. gossypina	CBS 104.32 ^T	KP125054	KP124584	KP124430	JQ646312	KP125209	KP124900	JQ646395	KP124135	KP124746
A. iridiaustralis	CBS 118486 ^T	KP125059	KP124589	KP124435	KP124284	KP125214	KP124905	KP123981	KP124140	KP124751
A. jacinthicola	CBS 133751 ^T	KP125062	KP124592	KP124438	KP124287	KP125217	KP124908	KP123984	KP124143	KP124754
A. longipes	CBS 540.94 ^R	KC584541	KC584285	AY278835	AY278811	KC584667	KC584409	AY563304	KP124147	KP124758
A. avenicola	CBS 121459 ^T	KC584512	KC584256	KC584183	KC584100	KC584639	KC584380	-	-	-
A. brassicicola	CBS 118699 ^R	KC584515	KC584259	JX499031	KC584103	KC584642	KC584383	-	-	-
A. infectoria	CBS 210.86 ^T	KC584536	KC584280	DQ323697	AY278793	KC584662	KC584404	-	-	-
A. papavericola	CBS 116606 ^T	KC584579	KC584321	FJ357310	FJ357298	KC584705	KC584446	-	-	-
A. solani	CBS 109157 ^T	-	-	KJ718238	GQ180080	KJ718585	KJ718413	KJ718746	-	-

T: ex-type strain; R: representative strain.

SSU, small subunit ribosomal RNA; LSU, large subunit ribosomal RNA; ITS, internal transcribed spacer region; gapdh, glyceraldehyde 3-phosphate dehydro tion factor 1-alpha; rpb2, RNA polymerase second largest subunit; Alt a 1, Alternaria major allergen gene 1; endoPG, endopolygalacturonase; OPA10-2, an a ogenase; tef1, translation elonganonymous region.

They are generated in this study.