Res. Plant Dis > Volume 31(1); 2025 > Article
복숭아에서 5종 바이러스 및 바이로이드를 동시에 검출하기 위한 Multiplex RT-PCR 진단법 개발

요 약

우리나라 복숭아에서 발생이 보고된 3종의 바이러스 ACLSV, PBNSPaV, PaLV와 2종의 바이로이드 PLMVd, HSVd를 검출하기 위하여 multiplex RT-PCR (mRT-PCR) 진단법을 개발하였다. 각 바이러스에 대한 종 특이적 프라이머를 설계하고 최적화하여 높은 민감도와 특이성을 보이는 하나의 프라이머 세트를 조합하였다. 개발된 프라이머의 검출한계는 개별 및 다중 진단 조건에서 total RNA를 연속적으로 희석하여 평가하였다. mRT-PCR 방법은 경북 지역에서 수집된 80품종 175개의 다양한 복숭아 품종에 적용하여 바이러스 감염을 확인할 수 있었다. 이 mRT-PCR 분석법은 다수의 바이러스와 바이로이드를 동시에 검출할 수 있는 신속하고 민감하며 향상된 활용성을 제공할 수 있으며, 기존 방법에 비해 복숭아 감염 바이러스와 바이로이드 5종에 대한 대량의 발생 조사와 역학 연구, 무병묘 생산에 활용될 것으로 기대된다.

ABSTRACT

A multiplex reverse transcription-polymerase chain reaction (mRT-PCR) assay was developed for the simultaneous detection of three viruses and two viroids infecting peach trees, including apple chlorotic leaf spot virus, plum bark necrosis stem pitting-associated virus, peach-associated luteovirus, peach latent mosaic viroid, and hop stunt viroid, which have been reported in peach trees in Korea. Species-specific primers were designed, optimized, and integrated into a single primer set to ensure high sensitivity and specificity. Detection limits of the primers were assessed using serial dilution of total RNA under both single and multiplex conditions. The mRT-PCR assay was subsequently applied to 175 peach samples from 80 cultivars collected in the Gyeongbuk region, successfully identifying viral infections across a diverse range of peach varieties. This mRT-PCR assay is rapid, sensitive, and scalable diagnostic tool that allows for the simultaneous detection of multiple viruses and viroids, offering significant advantages over conventional methods. Its suitability for large-scale prevalence surveys and epidemiological studies, as well as its effectiveness in producing disease-free seedlings, makes it particularly valuable for managing peach-infecting viruses and viroids.

복숭아 (Prunus persica L.)는 장미과 (Rosaceae) 벚나무속 (Prunus)에 속하는 과수로, 사과, 배, 포도, 감귤과 함께 재배되는 주요 과수 작물 중 하나이다. 복숭아 생산액은 최근 10년 간 꾸준히 증가하여 2022년에는 약 7,500억 원, 재배면적은 약 20,000 ha이며 생산량은 약 20만 톤으로 중요한 경제적 가치를 지니고 있다(Ministry of Agriculture, Food and Rural Affairs, 2023). 복숭아의 바이러스 및 바이로이드병의 감염은 복숭아 나무의 생장과 과실의 기형과 같이 품질을 저하시켜 복숭아 생산에 손실을 유발할 수 있다(Cambra 등, 2008; Marquez-Molins 등, 2021; Pusey와 Yadava, 1991; Uyemoto 등, 1992).
복숭아를 포함한 대부분의 과수 작물은 접목과 같이 영양 번식체를 이용하여 묘목을 생산하게 되는데, 이때 바이러스가 감염된 접수 또는 대목에 의해 바이러스가 전염된다. 국내에서는 복숭아 묘목의 종자 보증을 위해 apple chlorotic leaf spot virus (ACLSV)와 hop stunt viroid (HSVd) 2종에 대하여 특정병으로 지정하고 무병묘를 생산하고 있다(Korea Seed & Variety Service, 2024). 복숭아는 다양한 품종이 도입되거나 육종되고 있으며, 최근에는 차세대 염기서열 분석법(next generation sequencing, NGS)과 같은 바이러스 진단 기술의 발달로 인해 plum bark necrosis stem pitting-associated virus (PBNSPaV), cherry-associated luteovirus (ChALV), nectarine stem pitting-associated virus (NSPaV), peach latent mosaic viroid (PLMVd), peach leaf pitting-associated virus 등이 국내에 새롭게 보고되었다(Igori 등, 2017; Jo 등, 2016, 2017, 2019).
국내 복숭아에 감염하는 바이러스 중 ACLSV, HSVd, PBNSPaV는 45-80%, 특히 PLMVd 100%의 높은 감염률을 보였다(Bak 등, 2017; Cho 등, 2012). ACLSV는 다양한 기주 범위와 높은 유전적 다양성을 갖고 있다(Al Rwahnih 등, 2004; Liu 등, 2014; Zuļģ e 등, 2023). 복숭아에서 분리한 ‘ Ta Tao 5’ 분리주는 기존의 다른 ACLSV 그룹의 분리주들과 72-75.6%의 상동성을 보였다(Marini 등, 2008; Zhou 등, 2018). 낮은 상동성으로 인해 바이러스를 검출하지 못할 수 있으므로 기존의 ACLSV 계통과 ‘ Ta Tao 5’ 계통을 동시에 검출할 수 있도록 설계하였다. 연구에 활용된 peach-associated luteovirus (PaLV) 시료는 선행 연구에서 NGS 분석을 통해 검출되었으며, Wu 등(2017)이 보고한 PaLV-IVIM18 (KY635989) 분리주와 99.74%의 nucleotide 상동성을 보였다. 국내에서는 같은 Luteovirus 속 바이러스인 ChALV와 NSPaV가 복숭아에서 보고되었다(Igori 등, 2017; Jo 등, 2017). PaLV는 국내 분포 조사나 특성 조사 연구가 부족하므로, 효율적이고 경제적으로 검출할 수 있는 multiplex reverse transcription-polymerase chain reaction (mRT-PCR) 기술을 활용하여 진단법을 개발하였다.
복숭아의 바이러스 및 바이로이드 다중 진단 검출 방법은 ACLSV, HSVd, NSPaV, Asian prunus virus 2 4종의 mRT-PCR 진단법이 개발되었다(Lee, 2021). 그러나 국내 복숭아에서 발생하는 ACLSV, HSVd, PBNSPaV, PLMVd, PaLV 5종을 동시에 진단하는 방법은 아직 개발되지 않았다. 복숭아 바이러스 및 바이로이드병 동시 진단법은 시간과 비용을 절감하고 정확한 진단이 가능하여 병 발생 조사 및 역학 연구, 바이러스 무병묘(virus-free) 생산에 신속하고 경제적인 기술로 활용될 수 있다. 따라서 본 연구에서는 국내에서 복숭아의 주요 감염 바이러스 3종(ACLSV, PBNSPaV, PaLV) 바이로이드 2종(PLMVd, HSVd)에 대하여 mRT-PCR을 이용한 동시진단 방법을 개발하고자 한다.

시료 채집 및 total RNA 추출.

mRT-PCR 개발에 사용된 복 숭아 바이러스 감염 잎 시료들은 2023년도 상주 중앙과수묘목센터에서 제공받았다. 복숭아 시료들은 이전 시험에서 NGS 분석을 통하여 바이러스의 감염 여부와 종을 확인하였으며(data not shown), 이후 -80 o C에 보관하여 실험에 사용하였다. 감염 시료는 파쇄 후 자동핵산추출기인 Nuclisens E-Mag (Bioméri-eux, Marcy l’ Etoile, France)을 사용하여 total RNA를 추출하였고, Tecan Infinite M200 Pro (Tecan, Männedorf, Switzerland)를 사용하여 핵산의 농도와 순도를 측정하여 RT-PCR 진단에 사용하였다.

Primer 설계와 multiplex RT-PCR 진단.

각 바이러스별 종 특이 프라이머 세트를 설계하기 위해 전체 염기서열을 National Center for Biotechnology Information GeneBank 데이터베이스에서 다운로드하여 Geneious prime 소프트웨어(Domatics, San Diego, CA, USA)를 사용하여 정렬하였다. 각 프라이머 세트들은 변이가 적고 보존이 잘 되어있는 염기서열 부분 또는 바이러스의 경우 외피 단백질(coat protein) 염기서열 부분으로 설계되었다(Table 1). 5종의 병원체를 동시에 검출하기 위하여 모든 프라이머 세트의 annealing 온도는 58 o C로 고정하여 설계하였다.
Table 1.
Specific primer sets of a mRT-PCR for the detection of three viruses and two viroids
No. Primer name Sequence (5′-3′) Loci Target region Size (bp)
1 ACLSV-F a GCAGACCCCTTCATGGAAAGA 6,835-6,855 CP 479
ACLSV-Ta-F AGGCCAATCGTCCCTTGCAT 6,811-6,830
ACLSV-4R CGCCTCATTCTCACTTTTTGCA 7,313-7,292
2 PBNSPaV-2F-1 CAGTCAAAACAGCTGCACCT 12,866-12,885 CP 338
PBNSPaV-2R TGCCACCATACGACCCAACT 13,209-13,190
3 PaLV-2F CATACCTCAGTTCAAGCCGC 2,760-2,777 CP 297
PaLV-2R-1 CCGTCCTCCAGATTGTACGT 3,057-3,038
4 PLMVd-4F TCTCAACGGCTCATCAGTGG 18-37 - 235
PLMVd-4R′ TTTGAATCCCGGGTAGACGT 233-252
5 HSVd-1F GAATTCTCGAGTTGCCGCAA 6-25 - 173
HSVd-1R AGGGACGATCGATGGTGTTT 159-178

mRT-PCR, multiplex reverse transcription-polymerase chain reaction; ACLSV, apple chlorotic leaf spot virus; CP, coat protein; PBNSPaV, plum bark necrosis stem pitting-associated virus; PaLV, peach-associated luteovirus; PLMVd, peach latent mosaic viroid; HSVd, hop stunt viroid.

a Primer used in this table were extracted from the Seed Testing Guidelines (Korea Seed & Variety Service, 2024).

mRT-PCR은 바이러스 및 바이로이드에 감염된 복숭아 잎으로부터 추출한 total RNA를 주형으로 수행되었다. mRT-PCR 반응은 SuPrimeScript RT-PCR Premix Kit (Genet Bio, Daejeon, Korea)를 사용하여 42 o C에서 30분간 역전사 반응과 95 o C 5분, 1 cycle, 95 o C 30초, 58 o C 1분, 72 o C 10분, 35 cycle, 72 o C 10분 1 cycle 조건으로 수행하였다. 증폭된 PCR 산물은 3% agarose gel에서 40분간 전기영동하여 Gel Doc XR+ Gel Documentation System (Bio-Rad, Hercules, CA, USA)으로 증폭된 PCR 산물 밴드를 확인하였다. 바이러스 및 바이로이드 검출에 최적화된 조건을 설정하기 위하여 각 프라이머들의 농도를 조절한 결과, ACLSV 2 pmol (ACLSV-4R은 3 pmol), PBNSPaV 2 pmol, PaLV 3 pmol, PLMVd 4 pmol, HSVd 30 pmol의 조건에서 각각 예상되는 위치에서 명확한 밴드를 확인할 수 있었다. 증폭된 PCR 산물은 염기서열을 분석 의뢰하여 종 특이적으로 증폭된 바이러스와 바이로이드 서열을 확인하였다. 또한, 최적화된 프라이머 농도 조건으로 단일 감염부터 복합 감염에 대한 mRT-PCR을 수행하였으며 각 바이러스와 바이로이드가 동시 검출이 가능함을 확인하였다(Fig. 1).
Fig. 1.
Simultaneous detection using the specific primer sets for the three viruses and two viroids by multiplex reverse transcription-polymerase chain reaction. Lane 1-5, detection of single infection; Lane 6-15, detection of double infection; Lane 16-25, Detection of triple infection; Lane 26-30, detection of quadruple infection; Lane 31, detection of quintuple infection; M, 100 bp DNA ladder; N, Negative control. ACLSV, apple chlorotic leaf spot virus; PBNSPaV, plum bark necrosis stem pitting-associated virus; PaLV, peach-associated luteovirus; PLMVd, peach latent mosaic viroid; HSVd, hop stunt viroid.
RPD-2025-31-1-112f1.jpg

mRT-PCR 의 검출한계 시험.

mRT-PCR의 검출한계를 확인 하기 위하여 약 700 ng/µl의 total RNA를 10-0부터 10-7까지 10배씩 연속적으로 농도를 희석하였으며, 단일 RT-PCR과 mRT-PCR 을 수행하였다. 단일 RT-PCR의 경우 ACLSV, PBNSPaV, PaLV는 10-5 (Fig. 2A, C, D), ACLSV ‘ Ta Tao 5’ 계통과 HSVd는 10-3의 농도에서 증폭이 되었고(Fig. 2B, F) PLMVd는 10-6의 희석 농도에서 검출이 되는 것을 확인하였다(Fig. 2E). 단일 RT-PCR 실험에서 HSVd의 다중밴드는 circular RNA 특성으로 다양한 cDNA가 생산되어 증폭된 것으로 판단되며 mRT-PCR에서는 다중밴드가 보이지 않았다. mRT-PCR의 검출한계 시험에서는 5종의 병원체가 모두 검출되는 농도는 10-4였으며, ACLSV는 10-5의 농도까지 검출되었다(Fig. 2G). 반면, ‘ Ta Tao 5’ 계통의 ACLSV 감염 시료(HSVd 미감염)에서는 10-3배의 농도에서 4종의 바이러스가 모두 검출되었으며 PBNSPaV, PaLV, PLMVd는 10-4의 농도까지 검출되었다(Fig. 2H).
Fig. 2.
Sensitivity analysis of primer sets for peach viruses and viroids. (A) Detection of ACLSV. (B) Detection of ACLSV-Ta Tao 5 strain. (C) Detection of PBNSPaV. (D) Detection of PaLV. (E) Detection of PLMVd. (F) Detection of HSVd. (G) Detection of ACLSV + PBNSPaV + PaLV + PLMVd + HSVd. (H) Detection of ACLSV- Ta Tao 5 strain + PBNSPaV + PaLV + PLMVd. Lane M, 100 bp DNA ladder. ACLSV, apple chlorotic leaf spot virus; PBNSPaV, plum bark necrosis stem pitting-associated virus; PaLV, peach-associated luteovirus; PLMVd, peach latent mosaic viroid; HSVd, hop stunt viroid.
RPD-2025-31-1-112f2.jpg

복숭아 품종별 mRT-PCR 진단법 검증.

mRT-PCR 진단법 의 유효성을 평가하기 위해 국내 주요 복숭아 품종을 대상으로 검증을 실시하였다. 2024년 복숭아의 바이러스 및 바이로이드 검사를 위해 경북 김천에서 모자이크, 황화, 엽맥 퇴록 등 바이러스 증상과 바이러스 증상을 보이지 않는 복숭아 80품종 총 175점의 잎 시료를 채집하였다(Supplementary Table 1). 수집된 시료들은 모두 단일 RT-PCR과 mRT-PCR 진단법을 사용하여 바이러스와 바이로이드의 감염 여부를 확인하였다. 검사 결과, 161점의 시료가 단일 또는 복합적으로 감염되었고 나머지 14점의 시료에서는 미검출이었다(Fig. 3). 단일 RT-PCR 결과는 mRT-PCR 검출 결과와 일치하였다(data not shown). 감염된 161점의 시료 중, 단일 감염은 45점(25.7%)이었으며, 나머지 116점(66.3%)은 2종 이상 복합 감염으로 나타났다. 2종 감염은 55점(31.4%), 3종 감염은 44점(25.1%), 4종 감염은 14점(8.0%), 5종 감염은 3점(1.7%)이었다. 각 바이러스의 감염 양상은 ACLSV 가 100점(57.1%), PBNSPaV는 72점(41.1%), PaLV는 7점(4.0%), PLMVd는 150점(85.7%), HSVd는 21점(12.0%)이었다. 이전 Bak 등(2017)과 Lee (2021)의 국내 복숭아 바이러스 및 바이로이드 감염 조사와 마찬가지로 ACLSV, PBNSPaV, PLMVd, HSVd 는 복숭아에서 가장 많이 발생하는 주요 바이러스와 바이로이드로 확인되었다. 대부분의 복숭아 나무는 바이러스 및 바이로이드에 복합적으로 감염되어있어, 빠르게 5종의 병원체를 동시에 검출하기 위해서는 mRT-PCR이 효과적인 것으로 판단된다. 또한, 대부분의 품종에서 바이러스 및 바이로이드 감염 여부를 판독하는 위치에 비특이적 밴드나 다이머(dimer)는 관찰되지 않았다. 그러나 대양, 쓰쿠바4호 2품종에 대해서는 비특이 반응을 보여 바이러스 및 바이로이드 진단에 주의가 필요할 것으로 판단된다(Fig. 3; Lane 127, 128, 151, 152). 이러한 결과는 ACLSV, PBNSPaV, PaLV, PLMVd, HSVd를 동시에 검출할 수 있는 mRT-PCR 진단법이 복숭아 바이러스 및 바이로이드를 진단하는 조사 연구나 무병묘를 생산하는 현장에서 활용할 수 있을 것으로 판단된다.
Fig. 3.
Simultaneous diagnostic testing for viruses and viroids in 80 peach cultivars (175 samples). Lane M, 100 bp DNA ladder; Lane P, positive control; Lane N, negative control.
RPD-2025-31-1-112f3.jpg
본 연구에서 개발된 mRT-PCR 진단법은 국내 복숭아에 발생하는 주요 바이러스와 바이로이드에 대한 5종의 프라이머 세트를 조합하여 기존의 단일 RT-PCR 대비 병원체를 효율적으로 검출할 수 있음을 확인하였다. 또한, 국내에서 재배된 복숭아 나무 80품종 175주를 조사하여 3종의 바이러스와 2종의 바이로이드의 단일 및 복합 감염을 성공적으로 검출하였다. 이는 개발된 mRT-PCR 진단법이 진단 현장에서 복숭아 바이러스 및 바이로이드 병의 신속하고 정확한 검출을 할 수 있기 때문에 대규모 조사 연구, 무병묘 생산에 효과적으로 기여할 수 있을 것이다.

NOTES

Conflicts of Interest

No potential conflict of interest relevant to this article was reported.

Acknowledgments

This research was supported by a grant from the IPET (Korea Institute of Planning and Evaluation for Technology in Food, Agriculture and Forestry; Project No. 320040-05), Ministry for Agriculture, Food and Rural Affairs, Republic of Korea.

Electronic Supplementary Material

Supplementary materials are available at Research in Plant Disease website (http://www.online-rpd.org/).

Supplementary Table 1.

Variety information for mRT-PCR samples used for diagnosis of virus and viroid infections in peach trees
RPD-2025-31-1-112-Supplementary-Table-1.pdf

REFERENCES

Al Rwahnih, M., Turturo, C., Minafra, A., Saldarelli, P., Myrta, A., Pallás, V. et al. 2004. Molecular variability of apple chlorotic leaf spot virus in different hosts and geographical regions. J. Plant Pathol. 86: 117-122.
Bak, S., Seo, E., Kim, S. Y., Park, W. H. and Lee, S.-H. 2017. First report of Apricot pseudo-chlorotic leaf spot virus infecting peach trees in South Korea. Res. Plant Dis. 23: 75-81. (In Korean)
crossref
Cambra, M., Flores, R., Pallas, V., Gentit, P. and Candresse, T. 2008. Viruses and viroids of peach trees. The peach: botany, production and uses. pp. 435-466. CABI, Wallingford, UK.
crossref
Cho, I. S., Cho, J. D., Choi, S. K. and Choi, G. S. 2012. Occurrence of stone fruit viruses on peach trees (Prunus persica L. Batsch) in Korea. Res. Plant Dis. 18: 391-395. (In Korean)
crossref
Igori, D., Lim, S., Baek, D., Cho, I. S. and Moon, J. S. 2017. Complete nucleotide sequence of a highly divergent cherry-associated luteovirus (ChALV) isolate from peach in South Korea. Arch. Virol. 162: 2893-2896.
crossref pmid pdf
Jo, Y., Cho, J. K., Choi, H., Lian, S. and Cho, W. K. 2017. First report of nectarine stem pitting-associated virus and Plum bark necrosis and stem pitting-associated virus infecting a peach cultivar in Korea. Plant Dis. 101: 1067.
crossref
Jo, Y., Choi, H., Back, C.-K., Chu, H., Zhou, Y., Lian, S. et al. 2019. First report of peach leaf pitting-associated virus in peach trees ex-hibiting calico in Korea. Plant Dis. 103: 2971.
crossref
Jo, Y., Choi, H., Cho, J. K., Yoon, J.-Y., Choi, S.-K. and Cho, W. K. 2016. First report of peach latent mosaic viroid in peach trees in Korea. Plant Dis. 100: 234.
crossref
Korea Seed & Variety Service. 2024. Seed Testing Guidelines, Annex 11: Diagnostic Methods for Virus and Viroid in Fruit trees. Korea Seed & Variety Service, Gimcheon, Korea.
Lee, T. 2021. Development of multiple diagnostic methods for testing peach virus and viroid. Master's thesis.Kyungpook National University, Daegu, Korea.
Liu, P., Li, Z., Song, S. and Wu, Y. 2014. Molecular variability of apple chlorotic leaf spot virus in Shaanxi, China. Phytoparasitica 42: 445-454.
crossref pdf
Marini, D. B., Gibson, P. G. and Scott, S. W. 2008. The complete nucleotide sequence of an isolate of apple chlorotic leaf spot virus from peach (Prunus persica (L.) Batch). Arch. Virol. 153: 1003-1005.
crossref pmid pdf
Marquez-Molins, J., Gomez, G. and Pallas, V. 2021. Hop stunt viroid: a polyphagous pathogenic RNA that has shed light on viroid-host interactions. Mol. Plant Pathol. 22: 153-162.
crossref pmid pmc pdf
Ministry of Agriculture, Food and Rural Affairs (MAFRA). 2023. 2023 Major Statistics of the Ministry of Agriculture. Food and Rural Affairs. MAFRA, Sejong, Korea.
Pusey, P. L. and Yadava, U. L. 1991. Influence of prunus necrotic ringspot virus on growth, productivity and longevity of peach trees. Plant Dis. 75: 847-851.
crossref
Uyemoto, J. K., Asai, W. K. and Luhn, C. F. 1992. Ilarviruses: evidence for rapid spread and effects on vegetative growth and fruit yields of peach trees. Plant Dis. 76: 71-74.
crossref
Wu, L.-P., Liu, H.-W., Bateman, M., Liu, Z. and Li, R. 2017. Molecular characterization of a novel luteovirus from peach identified by high-throughput sequencing. Arch. Virol. 162: 2903-2905.
crossref pmid pdf
Zhou, J., Zhang, Z., Lu, M., Xiao, H., Habili, N. and Li, S. 2018. Complete nucleotide sequence of a new virus, peach chlorotic leaf spot virus, isolated from flat peach in China. Arch. Virol. 163: 3459-3461.
crossref pmid pdf
Zuļģe, N., Gospodaryk, A. and Moročko-Bičevska, I. 2023. Genetic diversity and phylogenetic relationships of apple chlorotic leaf spot virus isolates from Malus, Pyrus and Prunus hosts in Latvia. Plant Pathol. 72: 900-911.
crossref pdf


ABOUT
BROWSE ARTICLES
EDITORIAL POLICY
FOR CONTRIBUTORS
Editorial Office
Rm,904 (New Bldg.) The Korean Science & Technology Center 22, Teheran-ro 7-gil, Gangnam-gu, Seoul 06130, Korea
Tel: +82-2-557-9360    Fax: +82-2-557-9361    E-mail: paper@kspp.org                

Copyright © 2026 by The Korean Society of Plant Pathology.

Developed in M2PI

Close layer
prev next