Re-identification of <i>Fusarium sambucinum</i> Species Complex Strains in Korea and Their Literature Review

Yunhee Choi; Anbazhagan Mageswari; Hyorim Choi; Jisu Lee; Daseul Lee; Seung-Beom Hong

doi:10.5423/RPD.2023.29.2.118

Res. Plant Dis > Volume 29(2); 2023 > Article

국내에서 분리된 Fusarium sambucinum 종복합체 균주의 재동정 및 문헌 고찰

Research Article

Research in Plant Disease 2023;29(2):118-129.

Published online: June 30, 2023

DOI: https://doi.org/10.5423/RPD.2023.29.2.118

국내에서 분리된 Fusarium sambucinum 종복합체 균주의 재동정 및 문헌 고찰

최윤희, MageswariAnbazhagan, 최효림, 이지수, 이다슬, 홍승범^*

농촌진흥청 국립농업과학원 농업미생물과

Re-identification of Fusarium sambucinum Species Complex Strains in Korea and Their Literature Review

Yunhee Choi, Anbazhagan Mageswari, Hyorim Choi, Jisu Lee, Daseul Lee, Seung-Beom Hong^*

Agricultural Microbiology Division, National Institute of Agricultural Sciences, Rural Development Administration, Wanju 55365, Korea

^*Corresponding author
Tel: +82-63-238-3025 Fax: +82-63-238-3845 E-mail: funguy@korea.kr

Received March 21, 2023 Revised April 15, 2023 Accepted April 21, 2023

This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

요 약

Fusarium sambucinum 종 복합체는 식물에 심각한 질병을 일으키는 분류군이다. 국내에서는 F. sambucinum 종 복합체가 일으키는 식물병에 대한 많은 연구가 보고되었으나, 한국식물병명목록에는 2종(F. graminearum, F. sambucinum)이 14개의 기주에 식물병을 일으키는 정보만이 등록되어 있다. F. sambucinum 종복합체의 다양성 및 병원성을 확인하기 위해 농업미생물은행(Korean Agricultural Culture Collection)에 보존된 57균주의 F. sambucinum 종 복합체를 다중 유전자 염기서열 분석(multi-locus sequence typing)을 바탕으로 7종(F. asiaticum, F. graminearum, F. vorosii, F. meridionale, F. bootii, F. kyushuense, F. armeniacum)으로 재동정하였다. 이전의 보고와 이번 연구의 결과에 따라, F. sambucinum 종 복합체 중 5종(F. asiatum, F. graminearum, F. vorosii, F. armeniacum, F. sambucinum)이 24개의 기주에 병원성을 보였으며, 3종(F. meridionale, F. bootii, F. kyushuense)의 병원성은 명확하지 않았다.

ABSTRACT

Fusarium sambucinum species complex (FSAMSC) is an important taxonomic group, causing severe plant diseases. Many studies were carried out on FSAMSC plant diseases in Korea, but only 2 species (F. graminearum, F. sambucinum) from 14 host plants were registered in the List of Plant Disease in Korea. To clarify FSAMSC diversity and their pathogenecity, we examined FSAMSC isolates preserved in the Korean Agricultural Culture Collection. Fifty-seven strains were reidentifed as 7 species (F. asiaticum, F. graminearum, F. vorosii, F. meridionale, F. boothii, F. kyushuense, F. armeniacum) based on multi-locus sequence typing analysis. According to previous reports and result of this study, 5 species (F. asiaticum, F. graminearum, F. vorosii, F. armeniacum, F. sambucinum) were pathogenic on 24 host plants in FSAMSC, while the pathogenicity of 3 species (F. meridionale, F. boothii, F. kyushuense) were not clear.

Keywords: Fusarium sambucinum species complex, List of Plant Disease, Pathogenecity, Plant disease

서 론

Fusarium은 작물에 광범위한 질병을 일으키는 식물 병원성 곰팡이 중 하나이다(Summerell, 2019). 대표적으로 Fusarium 은 시들음병, 뿌리, 줄기 및 속 썩음병, 묘목의 역병, 구근 및 괴경의 썩음병을 유발하며, 일부 종은 진균독소를 생성하여 이삭 썩음병, 붉은곰팡이병, 줄기썩음병을 일으킨다(Bahadur, 2022).

Fusarium sambucinum 종복합체는 농업 환경에 가장 해로운 영향을 미치는, 붉은곰팡이병의 주요 병원체인 Graminearum clade를 포함하고 있기에 그 중요성은 더욱 크다(Goswami와 Kistler, 2004). 우리나라에서는 1963년 붉은곰팡이병으로 인해 남부지방에 80-100%의 손실이 발생된 적이 있었으며 이후에도 1974년, 1990년, 1998년에 주기적인 수율 감소로 경제적 손실이 있었다(Ryu 등, 2011). 농업 생태계에서 F. sambucinum 종복합체의 다양한 종이 상당히 큰 경제적 피해를 일으키기에 지속적인 연구를 통한 예방이 필요하다.

계통학적 종 인식(genealogical concordance phylogenetic species recognition)에 따르면, Fusarium은 23개의 종복합체로 구성되며 400개 이상의 종을 포함하고 있다(O’ Donnell 등, 2015, 2022). 그 중, F. sambucinum 종복합체는 가장 많은 종을 포함하며 진균독소를 생성하는 특성으로 인해 식물병리학자와 진균독성학자에게 큰 관심을 끌고 있다(Laraba 등, 2021; O’ Donnell 등, 2022).

우리나라에서도 많은 연구자들에 의해 F. sambucinum 종복합체가 일으키는 식물병이 보고되어 있으며, 분리된 균주의 일부는 농업미생물은행(Korean Agricultural Culture Collection, KACC)에 보관되어져 있다. 이에 따라, 국내에서 분리된 Fusarium 종의 확인을 위해, KACC에 2000년대 초반부터 장기 보존되어 있는 F. sambucinum 종복합체 균주를 최신 분류체계(Crous 등, 2021)에 맞게 재동정하여 확인하였다. F. sambucinum 종복합체를 동정하는데 필요한 분류체계는 단일 유전자의 사용이 아닌 다중 유전자를 사용한 분석이 이루어지고 있기에, 3개의 단백질 코딩 유전자인 translation elongation factor 1-α (tef1), RNA polymerase second largest subunit (rpb2) 및 RNA polymerase largest subunit (rpb1)을 사용하여 분석하였다(Crous 등, 2021).

국내 식물병의 정보를 확인할 수 있는 한국식물병명목록의 기록과 KACC 균주의 재동정 결과를 비교하였을 때 한국식물병명목록에는 많은 종이 반영되어 있지 않았다. 일부 종들은 보고는 되어 있으나, 한국식물병명목록에 등록되지 않고 KACC 에도 균주가 기탁되지 않은 것으로 판단되어, 국내에서 보고된 문헌을 추가로 조사하여 정리하였다.

본 연구에서는 국내에서 분리되어 KACC에 보존되어 있는 F. sambucinum 종복합체 균주를 재동정하고, 국내에서 보고된 문헌을 고찰하여, F. sambucinum 종복합체의 국내 병 발생 현황을 한국식물병명목록에 반영하고자 하였다.

재료 및 방법

균주 수집

KACC에 2000년부터 보관 중인 국내에서 분리된 F. sambucinum 종복합체 균주를 사용하였다(Table 1). -196° C, 10% 글리세롤(glycerol)에 보관된 균주는 potato dextrose agar (PDA) 배지와 malt extract agar (MEA) 배지에 25° C, 암조건에서 4-7일간 배양하였다.

Table 1.

Fusarium sambucinum species complex strains used in this study

Species name	Strain^a	Country	Host/Habitat	Name by depositor^b	Isolated date	Ref.^c	Accession no.^d
Species name	Strain^a	Country	Host/Habitat	Name by depositor^b	Isolated date	Ref.^c	tef1	rpb2	rpb1
*F. acaciae-mearnsii*	NRRL 26755	South Africa	*Australian acacia*			-	MW233086.1	MW233429.1	MW233257.1
*F. aethiopicum*	NRRL 46726 ^T	Ethiopia	*Triticum aestivum*			-	FJ240298	MW233470	MW233298
*F. armeniacum*	FRC R-9335 ^T	Australia	*Triticum aestivum*			-	GQ915501	GQ915485	KT597715
	KACC 43804	Korea	Soil	F. sporotrichioides*	May 2007	-	RDA0061580	RDA0061578	RDA0061579
	KACC 43805	Korea	Soil	F. sporotrichioides*	May 2007	-	RDA0061581	RDA0061583	RDA0061582
*F. asiaticum*	NRRL 13818 ^T	Japan	*Hordeum vulgare*			-	AF212451	JX171573	JX171459
	KACC 48824	Korea	Avena sativa	F. asiaticum	Jun 2018	1	RDA0060921	RDA0061433	RDA0061434
	KACC 48825	Korea	Avena sativa	F. asiaticum	Jun 2018	1	RDA0060922	RDA0061431	RDA0061432
	KACC 48826	Korea	Avena sativa	F. asiaticum	Jun 2018	1	RDA0061428	RDA0061429	RDA0061430
	KACC 47024	Korea	Coix lacryma-jobi	F. asiaticum	Oct 2012	-	RDA0060917	RDA0061445	RDA0061444
	KACC 41040	Korea	Hordeum vulgare	F. graminearum*	Jan 2011	3	RDA0061575	RDA0061577	RDA0061576
	KACC 41042	Korea	Hordeum vulgare	F. graminearum*	Jun 2000	-	RDA0061572	RDA0061574	RDA0061573
	KACC 46510	Korea	Meju (Oryza sativa)	F. asiaticum	Jan 2011	-	RDA0061453	RDA0061454	RDA0061455
	KACC 46511	Korea	Meju (Oryza sativa)	F. asiaticum	Jan 2011	-	RDA0061458	RDA0061457	RDA0061456
	KACC 46512	Korea	Meju (Oryza sativa)	F. asiaticum	Jan 2011	-	RDA0061461	RDA0061460	RDA0061459
	KACC 46513	Korea	Meju (Oryza sativa)	F. asiaticum	Jan 2011	-	RDA0061464	RDA0061463	RDA0061462
	KACC 46514	Korea	Meju (Oryza sativa)	F. asiaticum	Jan 2011	-	RDA0060913	RDA0061466	RDA0061465
	KACC 46428	Korea	Oryza sativa	F. asiaticum	Nov 2010	4	RDA0060912	RDA0061468	RDA0061467
	KACC 46429	Korea	Oryza sativa	F. asiaticum	Nov 2010	4	RDA0060911	RDA0061470	RDA0061469
	KACC 46430	Korea	Oryza sativa	F. asiaticum	Nov 2010	-	RDA0060910	RDA0061472	RDA0061471
	KACC 46577	Korea	Oryza sativa	F. graminearum*	May 2009	-	RDA0061565	RDA0061564	RDA0061563
	KACC 46886	Korea	Oryza sativa	F. asiaticum	Nov 2010	-	RDA0060916	RDA0061450	RDA0061449
	KACC 46887	Korea	Oryza sativa	F. asiaticum	Nov 2010	-	RDA0060915	RDA0061452	RDA0061451
	KACC 47319	Korea	Oryza sativa	F. asiaticum	Jan 2012	5	RDA0061443	RDA0061442	RDA0061602
	KACC 47495	Korea	Oryza sativa	F. graminearum*	Apr 2012	-	RDA0061547	RDA0061549	RDA0061548
	KACC 48483	Korea	Oryza sativa	F. asiaticum	Oct 2015	-	RDA0060919	RDA0061438	RDA0061437
	KACC 48484	Korea	Oryza sativa	F. asiaticum	Oct 2015	-	RDA0060918	RDA0061440	RDA0061439
	KACC 47025	Korea	Peucedanum japonicum	F. asiaticum	Jul 2012	-	RDA0061446	RDA0061447	RDA0061448
	KACC 48819	Korea	Sorghum bicolor	F. asiaticum	Sep 2018	2	RDA0060920	RDA0061436	RDA0061435
	KACC 47496	Korea	Triticum aestivum	F. graminearum*	Aug 2012	-	RDA0061552	RDA0061551	RDA0061550
	KACC 47498	Korea	Triticum aestivum	F. graminearum*	Aug 2012	-	RDA0061558	RDA0061557	RDA0061559
	KACC 47499	Korea	Triticum aestivum	F. graminearum*	Aug 2012	-	RDA0061560	RDA0061562	RDA0061561
	KACC 43800	Korea	Wood tie	F. culmorum*	Nov 2007	-	RDA0061541	RDA0061543	RDA0061542
	KACC 41046	Korea	Zea mays	F. graminearum*	Jun 2000	-	RDA0061571	RDA0061570	RDA0061569
	KACC 47497	Korea	Zea mays	F. graminearum*	Oct 2012	-	RDA0061553	RDA0061555	RDA0061554
	KACC 42099	Korea	Zoysia japonica	F. culmorum*	Jun 2004	-	RDA0061546	RDA0061545	RDA0061544
*F. austroamericanum*	NRRL 28585	Brazil	*Herbaceous vine*			-	MW233095.1	MW233438.1	MW233266.1
*F. boothii*	NRRL 26916 ^T	South Africa	*Zea mays*			-	GQ915503	KM361659	KM361641
	KACC 41047	Korea	Zea mays	F. graminearum*	Jun 2000	-	RDA0061566	RDA0061568	RDA0061567
	KACC 46431	Korea	Zea mays	F. boothii	Sep 2009	-	RDA0060909	RDA0061474	RDA0061473
	KACC 46432	Korea	Zea mays	F. boothii	Oct 2010	-	RDA0060908	RDA0061476	RDA0061475
*F. brachygibbosum*	NRRL 20954 ^T	India	*Sorghum vulgare*			-	MW233075	MW233418	MW233246
*F. brasilicum*	NRRL 31238	Brazil	*Barley*			-	MW233104.1	MW233448.1	MW233276.1
*F. cortaderiae*	NRRL 29297 ^T	New Zealand	*Cortaderia selloana*			-	AY225885	KM361662	KM361644
*F. culmorum*	NRRL 25475 ^ET	Denmark	*Hordeum vulgare*			-	MW233082	JX171628	JX171515
*F. dactylidis*	NRRL 29298 ^T	New Zealand	*Dactylis glomerata*			-	DQ459748	KM361672	KM361654
*F. gerlachii*	NRRL 36905 ^T	USA	*Triticum aestivum*			-	DQ459742	KM361664	KM361646
*F. goolgardi*	RBG 5411 ^T	Australia	*Xanthorrhoea glauca*			-	KP101123	KP083280	KP083270
*F. graminearum*	CBS 136009 ^ET	Germany	*Hordeum vulgare*			-	MW928838	MW928826	MW928810
	KACC 48828	Korea	Avena sativa	F. graminearum	Jun 2018	1	RDA0061479	RDA0061478	RDA0061480
	KACC 47026	Korea	Coix lacryma-jobi	F. graminearum	Jul 2012	-	RDA0061484	RDA0061485	RDA0061486
	KACC 46437	Korea	Hordeum vulgare	F. graminearum	Sep 2010	-	RDA0061496	RDA0061497	RDA0061498
	KACC 46438	Korea	Hordeum vulgare	F. graminearum	Sep 2010	-	RDA0061501	RDA0061500	RDA0061499
	KACC 46439	Korea	Hordeum vulgare	F. graminearum	Sep 2010	-	RDA0061504	RDA0061503	RDA0061502
	KACC 46434	Korea	Oryza sativa	F. graminearum	Nov 2010	-	RDA0061487	RDA0061488	RDA0061489
	KACC 46441	Korea	Oryza sativa	F. graminearum	Nov 2010	-	RDA0061507	RDA0061506	RDA0061505
	KACC 48818	Korea	Sorghum bicolor	F. graminearum	Sep 2018	2	RDA0061483	RDA0061482	RDA0061481
	KACC 46442	Korea	Triticum aestivum	F. graminearum	Sep 2010	-	RDA0061510	RDA0061509	RDA0061508
	KACC 41044	Korea	Zea mays	F. graminearum	Jun 2000	3	RDA0061513	RDA0061512	RDA0061511
	KACC 46435	Korea	Zea mays	F. graminearum	Nov 2010	-	RDA0061492	RDA0061491	RDA0061490
	KACC 46436	Korea	Zea mays	F. graminearum	Nov 2010	-	RDA0061493	RDA0061494	RDA0061495
*F. kyushuense*	MRC 1767 ^T	Japan	Seed of Triticum aestivum			-	MH582292	MH582098	MW233227.1
	KACC 47023	Korea	Coix lacryma-jobi	F. kyushuense	Jul 2012	-	RDA0061540	RDA0061539	RDA0061538
*F. langsethiae*	CBS 113234 ^T	Norway	Kernal of Avena sativa			-	AB674298	MW928828	MW928812
*F. longipes*	NRRL 20695 ^NT	USA	Soil			-	GQ915509	GQ915493	MW233244
*F. louisianense*	NRRL 54197 ^T	USA	*Seeds of Triticum* sp**.			-	KM889633	KM889657	KM889655
*F. lunulosporum*	NRRL 13393 ^T	South Africa	*Citrus paradisi*			-	AF212467	KM361655	KM361637
*F. meridionale*	NRRL 28436 ^T	New Caledonia	*Citrus sinensis*			-	AF212435	KM361660	KM361642
	KACC 48425	Korea	Zea mays	F. meridionale	Nov 2010	-	RDA0061514	RDA0061515	RDA0061516
	KACC 46433	Korea	Zea mays	F. meridionale	Nov 2010	-	RDA0061517	RDA0061518	RDA0061519
	KACC 46440	Korea	Zea mays	F. meridionale	Nov 2010	-	RDA0061522	RDA0061521	RDA0061520
*F. mesoamericanum*	NRRL 25797 ^T	Honduras	Musa sp.			-	AF212441	KM361657	KM361639
*F. musarum*	NRRL 28507 ^T	Panama	*Musa sapientum*			-	MW233094	MW928829	MW233265
*F. nepalense*	NRRL 54222 ^T	Nepal	*Oryza sativa*			-	KM889631	KM361668	KM361650
*F. nodosum*	CBS 201.63 ^T	Portugal	Seed of Arachis hypogaea			-	MN120763	MN120743	MN120725
*F. palustre*	NRRL 54056 ^T	USA	*Spartina alterniflora*			-	GQ856941	KT597731	KT597718
*F. poae*	LC 6917	China	*Oryza sativa*			-	MW620088.1	MW474613.1	MW024655.1
*F. praegraminearum*	NRRL 39664 ^T	New Zealand	Litter in maize paddock			-	KX260120	KX260126	KX260125
*F. pseudograminearum*	NRRL 28062 ^T	Australia	*Hordeum vulgare*			-	AF212468	JX171637	JX171524
*F. robustum*	NRRL 13392 ^T	Argentina	*Araucaria angustifolia*			-	MW233062.1	MW233405.1	MW233233.1
*F. sibiricum*	NRRL 53430 ^T	Russia	Grain of Avena sativa			-	HM744684	HQ154472	MW233302
*F. subtropicale*	NRRL 66764 ^T	Brazil	*Hordeum vulgare*			-	MH706974	MH706973	MH706972
*F. transvaalense*	LC 13784	USA	*Medicago sativa*			-	MW620089	MW474614	MW024656
*F. ussurianum*	NRRL 45681 ^T	Russia	Seed of Avena sativa			-	FJ240301	KM361666	KM361648
*F. venenatum*	NRRL 26228 ^T	Austria	Culm of Triticum aestivum			-	MW233085.1	MW233428.1	MW233256.1
*F. vorosii*	NRRL 37605 ^T	Hungary	Spikelet of Triticum aestivum			-	DQ459745	KM361665	KM361647
	KACC 48006	Korea	Hordeum vulgare	F. vorosii	Jan 2011	6	RDA0061532	RDA0061533	RDA0061534
	KACC 46885	Korea	Oryza sativa	F. vorosii	Oct 2010	7	RDA0061535	RDA0061536	RDA0061537
	KACC 48820	Korea	Sorghum bicolor	F. vorosii	Sep 2018	2	RDA0061526	RDA0061527	RDA0061528
	KACC 48829	Korea	Sorghum bicolor	F. vorosii	Sep 2018	1, 2	RDA0061523	RDA0061524	RDA0061525
	KACC 46443	Korea	Zea mays	F. asiaticum*	Nov 2010	-	RDA0061605	RDA0061603	RDA0061604
	KACC 48005	Korea	Zea mays	F. vorosii	Jan 2010	6	RDA0061531	RDA0061530	RDA0061529

Sequences generated at GenBank are shown in bold. RDA numbers are available on the KACC website (http://genebank.rda.go.kr). Other accession numbers are available on th NCBI website.

^a CBS: Westerdijk Fungal Biodiverity Institute (WI), Utrecht, The Netherlands; FRC: Fusarium Research Center, Pennsylvannia State University, PA; KACC: Korean Agricultural Cultur Collection, Agricultural Microbiology Division, Korea; LC: State Key Laboratory of Mycology, Institute of Microbiology, ChineseAcademy of Sciences, Beijing 100101, P. R. China NRRL: Agricultural Research Service Culture Collection, National Center for Agricultural Utilization Research, USDA, Peoria, IL, USA; MRC: Agricultural Research Council, Pretoria South Africa; RBG: Royal Botanic Gardens Trust, Sydney, New South Wales, Australia. ET: ex-epitype; NT: ex-neotype; T: ex-type.

^b Asterisks indicate strains which had scientific name change by re-identification.

^c 1, Choi et al., 2019a; 2, Choi et al., 2019b; 3, Lee et al., 2001; 4, Kim et al., 2012; 5, Kim et al., 2013; 6, Ok et al., 2014; 6, Lee et al., 2016; 7, Kim et al., 2016.

^d tef1, translation elongation factor 1-alpha; rpb2, RNA polymerase second largest subunit; rpb1, RNA polymerase largest subunit.

DNA 추출, polymerase chain reaction, 염기서열 분석

Genomic DNA 추출을 위한 균사체를 수집하기 위해 각 균주를 MEA 배지에 접종하고, 25° C, 암조건에서 4-7일간 배양하였다. DNeasy Plant Mini Kit (Qiagen, Hilden, Germany)의 이용 메뉴얼에 따라 전체 genomic DNA를 추출하였다. DNA 염기서열 분석은 tef1, rpb1와 rpb2의 부위를 대상으로 실시하였다. Polymerase chain reaction 증폭은 각각 EF1/EF2, F7/F8, 5f2/11ar 프라이머 쌍을 사용하였다(Table 2). 증폭된 샘플들은 동일한 프라이머 쌍을 사용하여 Macrogen (Seoul, Korea)에 염기서열 분석을 진행하였다.

Table 2.

Primer information for DNA amplification of Fusarium sambucinum species complex

Locus	Primer	Sequence (5’→3’)	Annealing temperature (°C)	References
tef1	EF-1	ATGGGTAAGGARGACAAGAC	55	O′ Donnell et al. (1998)
	EF-2	GGARGTACCAGTSATCATGTT		O′ Donnell et al. (1998)
rpb2	RPB2-5f2	GGGGWGAYCAGAAGAAGGC	58	Reeb et al. (2004)
	RPB2-11ar	GCRTGGATCTTRTCRTCSACC		Liu et al. (1999)
rpb1	F7	CRACACAGAAGAGTTTGAAGG	64	O′ Donnell et al. (2010)
	R8	CAATGAGACCTTCTCGACCAGC		O′ Donnell et al. (2010)

tef1, translation elongation factor 1-alpha; rpb2, RNA polymerase second largest subunit; rpb1, RNA polymerase largest subunit.

계통도 분석

분석된 염기서열은 DNASTAR Seqman II (DNASTAR, Madison, WI, USA)를 사용하여 편집하였다. F. sambucinum 종복합체에 속하는 표준 및 참조 균주는 NCBI GenBank database에서 얻었다. 편집된 염기서열은 MEGA version 7의 Clustal W를 사용하여 정렬하였고, 계통도는 maximum likelihood (ML)를 사용하여 분석하였다(Kumar 등, 2016). 개별 유전자 데이터는 1,000번의 bootstrap을 사용하여 분석되었다. 개별 유전자의 계통학적 분석을 수행한 다음 tef1, rpb2, rpb1 3가지 유전자 서열을 결합하여 분석하였다. 베이즈 정보 기준, 최적의 모델인 TN93+G를 사용하여 3가지 유전자가 결합된 계통도의 분석을 진행하였다.

결과 및 고찰

농업미생물은행(KACC)에서 보존하고 있는, 국내에서 분리된 57개의 균주를 tef1, rpb2, rpb1 유전자를 사용하여 재동정하였다(Fig. 1). ML 분석 결과, KACC 균주는 총 3 clade 및 7종으로 동정되었다. Graminearum clade (n=54)에서는 총 5종인 F. asisaticum (30), F. vorosii (6), F. boothii (3), F. meridionale (3), F. graminearum (12)으로, Sambucinum clade (2)에는 F. armeniacum (2), Sporotrichioides clade (1)에는 F. kyushuense (1)를 확인하였다.

Fig. 1.

The distribution of Fusarium sambucinum species complex in KACC. The tree was constructed by the Maximum Likelihood method based on TN93+G model using tef1, rpb1, and rpb2. Clade support was inferred from 1,000 bootstrap replicates and indicated values exceed 50%. Clade names are indicated on the right of the tree. Additional substrate information was indicated with circle in color represented on the left. Re-identified species from KACC strains are marked with bold. The tree was rooted on sequence of NRRL 25331 F. circinatum from the F. fujikuroi species complex. tef1, translation elongation factor 1-alpha; rpb2, RNA polymerase second largest subunit; rpb1, RNA polymerase largest subunit.

KACC 균주가 활용된 문헌은 표에 정리하였으나(Table 1), 그 정보가 부족하여 한국식물병명목록에서의 기록을 확인하였다. 한국식물병명목록에는 14개의 기주를 대상으로 식물병을 일으키는 2종(F. graminearum과 F. sambucinum)이 등록되어 있다. 한국식물병명목록에는 많은 정보가 누락되어 있어, KACC가 보유하고 있는 F. sambucinum 종복합체 균주의 정보와 국내에 보고된 Fusairum의 문헌을 비교하여 정리하였다(Table 3).

Table 3.

Comparison of host plants of Fusarium species among KACC strains, previous reports, and List of Plant Diseases in Korea

No.	Species	KACC strains	Previous reports	List of Plant Diseases in Korea
1	F. armeniacum		Coix lacryma-jobi (An et al., 2015)^a
			Glycine max (Jang et al., 2022)^b
			Oryza sativa (Hong et al., 2015)^a
2	F. asiaticum	Avena sativa^b	Avena sativa (Choi et al., 2019a)^b
		Coix lacryma-jobi^a	Coix lacryma-jobi (An et al., 2015)^a
		Hordeum vulgare^a	Hordeum vulgare (Jang et al., 2019)^b
		Oryza sativa^a	Oryza sativa (Jang et al., 2019)^b
			Panicum miliaceum (Choi et al., 2021)^a
		Peucedanum japonicum^a
		Triticum aestivum^a	Triticum aestivum (Jang et al., 2019)^b
		Zea mays^a	Zea mays (Jang et al., 2019)^b
		Zoysia japonica^a
3	F. boothii	Zea mays^a	Zea mays (Lee et al., 2012)^a
4	F. graminearum	Avena sativa^b	Avena sativa (Choi et al., 2019a)^b
		Coix lacryma-jobi^a	Coix lacryma-jobi (An et al., 2015)^a
			Cucumis melo (Kim and Kim, 2004)^b	Cucumis melo^b
			Dianthus caryophyllus (Han et al., 2001)^b	Dianthus caryophyllus^b
			Glycine max (Kang et al., 2020)^b	Glycine max^b
		Hordeum vulgare^a	Hordeum vulgare (Seo et al., 1998)^b	Hordeum vulgare^b
				Ipomoea batatas^b
				Lolium perenne^b
				Larix kaempferi^b
				Phleum pratense^b
		Oryza sativa^a	Oryza sativa (Lee et al., 2009)^b	Oryza sativa^b
			Panicum miliaceum (Choi et al., 2021)^a
				Pinus koraiensis^b
			Sorghum bicolor (Choi et al., 2013)^b	Sorghum bicolor^b
		Triticum aestivum^a		Triticum aestivum^b
		Zea mays^a	Zea mays (Seo et al., 1998)^b	Zea mays^b
5	F. kyushuense	Coix lacryma-jobi^a	Coix lacryma-jobi (An et al., 2015)^a
			Panicum miliaceum (Choi et al., 2021)^a
			Oryza sativa (Ok et al., 2014)^a
6	F. meridionale	Zea mays^a	Zea mays (Lee et al., 2012)^a
7	F. sambucinum		Cucumis melo (Kim and Kim, 2004)^b	Cucumis melo^b
8	F. vorosii	Hordeum vulgare^b	Hordeum vulgare (Lee et al., 2016)^b
		Oryza sativa^a	Oryza sativa (Lee et al., 2016)^b
		Zea mays^b	Zea mays (Lee et al., 2016)^b

^a Pathogenicity on host was not tested.

^b Pathogenicity on host was confirmed.

F. armeniacum & F. sambucinum

F. armeniacum은 1993년에 F. acuminautm subsp. armeniacum으로 호주, 미국, 남아프리카에서 분리되어 보고되었다(Burgess 등, 1993). 그 후, 2000년에 random amplified polymorphic DNA 분석을 통해 F. armeniaucum은 종의 지위를 부여받았다(Burgess와 Summerell, 2000).

국내에서는 콩(Glycine max)에 뿌리썩음병을 일으키는 F. armeniacum이 보고되었다(Jang 등, 2022). 벼(Oryza sativa) (Hong 등, 2015), 율무(Coix lacryma-jobi) 종자(An 등, 2015)에서 분리된 F. armeniacum이 논문에 사용되었으나 병원성에 대한 결과가 없기에 한국식물병명목록에 등록하기 위해서는 병원성 실험이 필요하다(Table 3). 흙에서 분리되어 2007년에 기탁된 KACC 43804, KACC 43805는 형태적 특징에 의하여 F. sporotrichioides로 동정된 후에 분자적 분석의 결과로 F. armeniacum으로 재동정되었다(Table 1, Fig. 1).

F. armeniacum과 같은 Sambucinum clade에 포함되는 F. sambucinum은 참외(Cucumis melo)에 열매썩음병을 일으키는 것으로 보고되었으나(Kim과 Kim, 2004), 농업미생물은행에는 해당 종의 균주가 보존되어 있지 않다.

위의 내용을 종합할 때에 Sambucinum clade에는 콩에서 분리된 F. armeniacum과 참외에서 분리된 F. sambucinum의 병원성이 확인되었고 그 외의 벼와 율무에서 분리된 F. armeniacum은 병원성 확인이 필요하다(Table 3).

F. asiaticum

F. asiaticum은 아시아 지역(중국, 네팔, 일본, 한국)과 남아메리카(브라질) 지역에 분포되어 있으며(O’ Donnell 등, 2004), 2000년에 7개의 계통으로 나뉘어 Fg (Fusairum graminearum) clade 내에서 계통번호인 lineage 6으로 최초 보고되었다(O’ Donnell 등, 2000). 그리고 2004년에 계통발생학적 분석을 통해 Fg clade내의 명명되지 않은 종을 F. asiaticum으로 보고하였다(O’ Donnell 등, 2004).

국내에서는 벼과의 다양한 기주인 귀리(Avena sativa) (Choi 등, 2019a), 밀(Triticum aestivum) (Jang 등, 2019), 벼(Jang 등, 2019), 보리(Hordeum vulgare) (Jang 등, 2019), 옥수수(Zea mays) (Jang 등, 2019)에서 붉은곰팡이병이 보고되었다. 하지만 수수(Sorghum bicolor) (Choi 등, 2019b)와 콩(Choi 등, 2020)에서의 분리된 F. asiaticum은 병원성이 없는 것으로 보고되었다. 기장(Panicum miliaceum) (Choi 등, 2021)과 율무(An 등, 2015)에서 분리된 F. asiaticum은 병원성에 관한 정보가 없기에 확인이 필요하다(Table 3).

KACC에는 귀리(Choi 등, 2019a)에서 분리한 KACC 48824 (P4), KACC 48825 (P8), KACC 48826 (P14), 벼에서 분리한(Kim 등, 2012) KACC 46428 (ESR3R6)와 KACC 46429 (ASR1R2), 보리에서 분리한(Lee 등, 2001) KACC 41040 (88-1), 볏짚에서 분리된(Kim 등, 2013) KACC 47319, 수수에서 분리한(Choi 등, 2019b) KACC 48819 (S45) 균주를 보관 중이다. 또한, 보고는 없으나 밀, 옥수수, 율무, 갯기름나물(Peucedanum japonicum), 잔디(Zoysia japonica)에서 분리한 균주를 보관 중이다(Table 1).

F. asiaticum으로 보관 중인 균주 중, 9균주는 F. gramin-iarum 으로 그리고 2균주는 F. culmorum 으로 기탁되었으나 본 실험에서 F. asiaticum으로 재동정되었다(Table 1). 2004년 이전에 기탁된 균주들은 F. asiaticum의 종명을 부여 받기 이전이었고 2004년 이후에 기탁된 것은 분자적 분석 없이 형태적 특징으로만 보관되었기 때문이다.

현재까지 한국식물병명목록에는 F. asiaticum이 기록되어 있지 않기에 위의 결과를 바탕으로 귀리(Choi 등, 2019a), 밀(Jang 등, 2019), 벼(Jang 등, 2019), 보리(Jang 등, 2019), 옥수수(Jang 등, 2019)에 붉은곰팡이병을 일으키는 F. asiaticum을 추가해야 한다.

F. boothii

F. boothii는 남아프리카에 분포되어, 2000년에 Fg clade의 lineage 3으로 처음 언급되고(O’ Donnell 등, 2000), 2004년에 계통발생학적 분석을 통해 종명인 F. boothii로 보고되었다(O’ Donnell 등, 2004).

국내에서는 2012년에 옥수수에서 분리하여 계통 간의 관계를 강조하기 위해 종명 대신 계통 번호인 lineage 3으로 논문에 사용되었다(Lee 등, 2012). 그러나 이 균주는 옥수수에서 분리는 되었으나, 병원성에 대한 정보는 없어 감염 여부의 확인이 필요하다. 이 균주는 현재 KACC에서 보관 중이지 않지만, 옥수수에서 분리한 다른 균주를 보관 중이다.

보관 균주 중, KACC 41047은 2000년도 당시 형태적 분석으로만 진행되어 F. graminearum으로 보존되었고 분자적 분석을 통해 F. boothii로 학명을 변경하였다(Table 1).

F. boothii의 식물병을 일으키는 정보가 없기에, KACC에 보존되어 있는 F. boothii 균주를 활용하여 병원성 실험을 진행할 필요성이 있다.

F. graminearum

F. graminearum은 Graminearum clade (Fg clade) 내에서 많은 종의 분화로 변화해왔다. 6개의 단일 유전자 서열을 이용하여 7개의 계통군으로(O’ Donnell 등, 2000), MAT 유전자 및 11개의 추가 유전자를 통해 명명되지 않은 종에 대해 보고되었다(O’ Donnell 등, 2004).

F. graminearum은 벼과 식물의 병원균으로써 세계적으로 알려져 있다. 특히 따뜻한 지역의 벼와 옥수수, 온대지역의 귀리, 보리, 잔디, 호밀(Secale cereale)에서 많이 발생되며(Ger-lach와 Nirenberg, 1982), 벼과 이외에도 애기장대(Arabidopsis thaliana) (Nalam 등, 2015), 콩(Broders 등, 2007) 등에서 병을 일으킨다고 보고되었다.

국내에서는 귀리(Choi 등, 2019a), 벼(Lee 등, 2009), 보리(Seo등, 1998)에 붉은곰팡이병, 수수(Choi 등, 2013)에 이삭곰팡이병, 옥수수(Seo 등, 1998)에 이삭썩음병, 참외(Kim과 Kim, 2004)에 열매썩음병, 카네이션(Dianthus caryophyllus) (Han 등, 2001)에 모마름병, 콩(Kang 등, 2020)에 뿌리 및 줄기 썩음병을 일으킨다는 보고가 있다. 추가로 한국식물병명목록에는, 고구마(Ipomoea batatas)에 밑썩음병, 밀, 호밀풀(Lolium perenne), 큰조아재비(Pinus koraiensis)에 붉은곰팡이병, 일본잎갈나무(Larix kaempferi)와 잣나무(Pinus koraiensis)에 모잘록병을 일으킨다는 정보를 확인할 수 있다(Table 3). 기장(Choi 등, 2021) 및 율무(An 등, 2015)에서의 분리는 보고되었으나, 병원성 확인이 필요하다.

KACC에서는 현재 귀리(Choi 등, 2019a)에서 분리한 KACC 48828 (O517), 수수(Choi 등, 2019b)에서 분리한 KACC 48818 (S1159), 옥수수(Lee 등, 2001)에서 분리한 KACC 41044 (H-11) 및 밀, 벼, 보리, 율무에서 분리한 균주를 보관 중이다(Table 1).한국식물병명목록에는 귀리(Choi 등, 2019a)에 붉은곰팡이병을 일으키는 식물병 정보를 추가해야 한다.

F. kyushuense

F. kyushuense는 처음에는 F. sporotrichioides로 혼돈되었지만, 후벽포자(chlamydospore)를 생성하지 않는 형태적 특징의 차이가 있으며 F. arthrosporioides와도 유사하지만 분생포자의 발생에 차이가 있는 종이다. F. kyushuense 는 1998년도에 일본 큐슈 지역의 밀과 시코쿠 지역에서의 비닐 플레이트(vinyl plate)에서 분리되어 보고되었다(Aoki와 O’ Donnell, 1998).

국내에서는 병원성 실험 없이 분리원에 대한 보고로 기장(Choi 등, 2021), 벼(Ok 등, 2014), 율무 종자(An 등, 2015)의 보고가 있다. 이 문헌에서 활용된 균주는 현재 KACC에서 보관 중이지 않고, 2012년에 율무에서 분리한 다른 균주를 보관 중이다(Table 1).

현재까지 국내에 F. kyushuense가 일으키는 식물병에 대한 정보가 없고, KACC에서도 1개의 균주만 보존하고 있기에 균주 확보를 위한 분리 및 병원성 실험이 필요하다.

F. meridionale

F. meridionale는 2000년에 lineage 2로 처음 보고되어(O’ Donnell 등, 2000), 2004년에 종명이 확정되었다(O’ Donnell 등, 2004).

국내에서는 2012년도에 옥수수에서 분리한 F. meridionale를 계통 번호인 lineage 2로 논문에 사용하였다(Lee 등, 2012). 그러나 옥수수에서 분리한 F. meridionale의 병원성 여부는 알려지지 않은 상태이다. 위 문헌에서 사용된 균주는 현재 KACC에서 보관 중이지 않고, 옥수수에서 분리한 다른 균주를 보관 중이다(Table 1). 이에 따라, KACC에서 보존 중인 균주를 활용해 병원성 실험을 진행 한 뒤 한국식물병명목록에 추가로 등록하는 과정이 필요하다.

F. vorosii

F. vorosii는 일본과 헝가리의 밀에서 분리되었으며, 2007년에 붉은곰팡이병의 분리주를 식별하는 과정에서 최초로 보고되었다(Starkey 등, 2007). 국내에서는 2016년에 벼, 보리에서 붉은곰팡이병을, 옥수수에서 이삭썩음병 및 밑둥썩음병의 발생이 확인되었다(Lee 등, 2016). 수수에서 분리한 F. vorosii도 있으나, 이는 수수에 병원성이 나타나지 않는 것으로 보고되었다(Choi 등, 2019b).

KACC에서는 문헌으로도 사용되어진, 벼에서 분리한(Kim 등, 2016) KACC 46885 (GWR12R1), 보리에서 분리한(Lee 등, 2016) KACC 48006 (#195), 수수 알곡에서 분리한(Choi 등, 2019b) KACC 48820 (S1620)과 KACC 48829 (S33), 옥수수에서 분리한(Lee 등, 2016) KACC 48005 (GWS)를 보관 중이다.

KACC에 보존된 F. vorosii 균주 중 문헌으로 보고되지 않은, KACC 46443은 tef1, rpb2를 이용한 분자적 분석 방법으로 2010년에 기탁되었지만 기탁자가 당시 참고했던 문헌(O’ Donnell 등, 2000)으로 인해 F. asiaticum으로 보존되어 왔고 이번 연구를 통해 재동정되었다.

따라서, 한국식물병명목록에는 벼와 보리에 붉음곰팡이병을 일으키고, 옥수수에 이삭썩음병과 밑둥썩음병을 발생시키는 F. vorosii를 추가해야 한다(Lee 등, 2016).

이상으로 국내에서는 F. sambucinum 종복합체에서 5종(F. armeniacum, F. asiatiucm, F. vorosii, F. graminearum, F. sambucinum)이 24개의 기주에 식물병을 일으키는 것으로 확인되었다. 콩에 뿌리썩음병을 일으키는 F. armeniacum, 귀리, 밀, 벼, 보리, 옥수수에 붉은곰팡이병을 일으키는 F. asiaticum, 고구마에 밑썩음병, 귀리, 밀, 벼, 보리, 큰조아재비, 호밀풀에 붉은곰팡이병을, 수수에 이삭곰팡이병, 옥수수에 이삭썩음병, 일본잎갈나무와 잣나무에 모잘록병, 참외에 열매썩음병, 카네이션에 모마름병, 콩에 뿌리 및 줄기 썩음병을 일으키는 F. graminearum, 참외에 열매썩음병을 일으키는 F. sambucinum, 벼와 보리에 붉은곰팡이병을, 옥수수에 이삭 및 밑둥 썩음병을 일으키는 F. vorosii을 확인하였다. 그러나 한국식물병명목록에는 보고된 것 중, 2개의 종(F. graminearum, F. sambucinum)과 14개의 기주에 대한 식물병만 등록되었기에, 3개의 종(F. armeniacum, F. asiatiucm, F. vorosii)과 함께 10개의 기주에 대한 식물병을 추가해야한다. 또한, 3종(F. boothii, F. meridionale, F. kyushuense)이 일으키는 식물병 정보가 없기에 추가적인 연구가 필요하다. 본 연구는 한국식물병명목록에 추가로 등록해야 할 정보를 제공 하고, 향후에 수행해야하는 Fusarium 연구에 필요한 종의 정보를 제시한다.

NOTES

Conflicts of Interest

No potential conflict of interest relevant to this article was reported.

Acknowledgments

This study was carried out with the suppot (PJ017286) of National Institute of Agricultural Sciences, Rural Development Administration, Republic of Korea.

REFERENCES

An, T. J., Kim, Y. G., Hur, M., Lee, J. H., Lee, Y. J., Cha, S. W. et al. 2015. Physicochemical treatment for the reduction of Fusarium spp. infested in adlay (Coix lacryma-jobi L.) seeds. Korean J. Medicinal Crop Sci. 23: 460-467.

Aoki, T. and O'Donnell, K. 1998. Fusarium kyushuense sp. nov. from Japan. Mycoscience 39: 1-6.

Bahadur, A. 2022. Current status of Fusarium and their management strategies. In: Fusarium: An Overview of the Genus, ed. by S. Mahyar Mirmajlessi, IntechOpen, London, UK.

Broders, K. D., Lipps, P. E., Paul, P. A. and Dorrance, A. E. 2007. Evaluation of Fusarium graminearum associated with corn and soybean seed and seedling disease in Ohio. Plant Dis. 91: 1155-1160.

Burgess, L. W., Forbes, G. A., Windels, C., Nelson, P. E., Marasas, W. F. O. and Gott, K. P. 1993. Characterization and Distribution of Fusarium acuminatum subsp. armeniacum subsp. nov. Mycologia 85: 119-124.

Burgess, L. W. and Summerell, B. A. 2000. Taxonomy of Fusarium: Fusarium armeniacum stat & comb. nov. Mycotaxon 75: 347-348.

Choi, H. W., Hong, S. K., Lee, Y. K. and Kim, W. G. 2013. Diversity and pathogenicity of Fusarium species associated with grain mold of sorghum. Korean J. Mycol. 41: 142-148.

Choi, H. W., Kim, S. and Hong, S. K. 2020. Diversity and pathogenic characteristics of Fusarium species isolated from wilted soy-beans in Korea. Korean J. Mycol. 48: 297-312.

Choi, J. H., Nah, J. Y., Jin, H. S., Lim, S. B., Paek, J. S., Lee, M. J. et al. 2019a. Identification and chemotype profiling of Fusarium species in Korean oat. Res. Plant Dis. 25: 157-163. (In Korean).

Choi, J. H., Nah, J. Y., Jin, H. S., Lim, S. B., Paek, J. S., Lee, M. J. et al. 2019b. Occurrence of Fusarium species in Korean sorghum grains. Res. Plant Dis. 25: 213-219. (In Korean).

Choi, J. H., Nah, J. Y., Lee, M. J., Jang, J. Y., Lee, T. and Kim, J. 2021. Fusarium diversity and mycotoxin occurrence in proso millet in Korea. LWT 141: 110964.

Crous, P. W., Lombard, L., Sandoval-Denis, M., Seifert, K. A., Schroers, H. J., Chaverri, P. et al. 2021. Fusarium: more than a node or a foot-shaped basal cell. Stud. Mycol. 98: 100116.

Gerlach, W. and Nirenberg, H. 1982. The Genus Fusarium: A Pictorial Atlas. Kommissionsverlag P. Parey, Berlin, Germany. pp. 406 pp.

Goswami, R. S. and Kistler, H. C. 2004. Heading for disaster: Fusarium graminearum on cereal crops. Mol. Plant Pathol. 5: 515-525.

Han, K. S., Park, J. H. and Park, Y. M. 2001. Stub dieback of carnation caused by. Fusarium graminearum. Plant Pathol. J. 17: 101-105.

Hong, S. K., Lee, S., Lee, T., Ham, H., Mun, H. Y., Choi, H. W. et al. 2015. Diversity of mycotoxigenic Fusarium armeniacum isolated from rice grains at harvest time in Korea. Korean J. Mycol. 43: 158-164.

Jang, J. Y., Baek, S. G., Choi, J. H., Kim, S., Kim, J., Kim, D. W. et al. 2019. Characterization of nivalenolproducing Fusarium asiaticum that causes cereal head blight in Korea. Plant Pathol. J. 35: 543-552.

Jang, Y., Yi, H., Maharjan, R., Jeong, M. and Yoon, Y. 2022. First report of root rot caused by Fusarium armeniacum on soybean in Korea. Plant Dis. 106: 1306.

Kang, I. J., Shim, H. K., Heu, S. and Kim, K. S. 2020. First report of soybean root and stem rot caused by Fusarium graminearum in South Korea. Plant Dis. 104: 568.

Kim, D. H., Kim, S. H., Kwon, S. W., Lee, J. K. and Hong, S. B. 2013. Fungal diversity of rice straw for meju fermentation. J. Microbiol. Biotechnol. 23: 1654-1663.

Kim, D. W., Kim, G. Y., Kim, H. K., Kim, J., Jeon, S. J., Lee, C. W. et al. 2016. Characterization of nivalenolproducing Fusarium culmorum isolates obtained from the air at a rice paddy field in Korea. Plant Pathol. J. 32: 182-189.

Kim, H. K., Cho, E. J., Lee, S., Lee, Y. S. and Yun, S. H. 2012. Functional analyses of individual mating-type transcripts at MAT loci in Fusarium graminearum and Fusarium asiaticum . FEMS Microbiol. Lett. 337: 89-96.

Kim, J. W. and Kim, H. J. 2004. Fusarium fruit rot of posthavest oriental melon (Cucumis melo L. var. makuwa Mak.) caused by Fusarium spp. Res. Plant Dis. 10: 260-267. (In Korean).

Kumar, S., Stecher, G. and Tamura, K. 2016. MEGA7: molecular evolutionary genetics analysis version 7.0 for bigger datasets. Mol. Biol. Evol. 7: 1870-1874.

Laraba, I., McCormick, S. P., Vaughan, M. M., Geiser, D. M. and O'Donnell, K. 2021. Phylogenetic diversity, trichothecene potential, and pathogenicity within Fusarium sambucinum species complex. PLoS ONE 16: e0245037.

Lee, J., Chang, I. Y., Kim, H., Yun, S. H., Leslie, J. F. and Lee, Y. W. 2009. Genetic diversity and fitness of Fusarium graminearum populations from rice in Korea. Appl. Environ. Microbiol. 75: 3289-3295.

Lee, J., Kim, H., Jeon, J. J., Kim, H. S., Zeller, K. A., Carter, L. L. A. et al. 2012. Population structure of and mycotoxin production by Fusarium graminearum from maize in South Korea. Appl. Environ. Microbiol. 78: 2161-2167.

Lee, T., Oh, D. W., Kim, H. S., Lee, J., Kim, Y. H., Yun, S. H. et al. 2001. Identification of deoxynivalenol- and nivalenolproducing chemotypes of Gibberella zeae by using PCR. Appl. Environ. Microbiol. 67: 2966-2972.

Lee, T., Paek, J. S., Lee, K. A., Lee, S., Choi, J. H., Ham, H. et al. 2016. Occurrence of toxigenic Fusarium vorosii among small grain cereals in Korea. Plant Pathol. J. 32: 407-413.

Liu, Y. J., Whelen, S. and Hall, B. D. 1999. Phylogenetic relationships among ascomycetes: evidence from an RNA polymerse II subunit. Mol. Biol. Evol. 16: 1799-1808.

Nalam, V. J., Alam, S., Keereetaweep, J., Venables, B., Burdan, D., Lee, H. et al. 2015. Facilitation of Fusarium graminearum infection by 9-lipoxygenases in arabidopsis and wheat. Mol. Plant Microbe-Interact. 28: 1142-1152.

O'Donnell, K., Kistler, H. C., Cigelnik, E. and Ploetz, R. C. 1998. Multiple evolutionary origins of the fungus causing Panama disease of banana: concordant evidence from nuclear and mitochondrial gene genealogies. Proc. Natl. Acad. Sci. U. S. A. 95: 2044-2049.

O'Donnell, K., Kistler, H. C., Tacke, B. K. and Casper, H. H. 2000. Gene genealogies reveal global phylogeographic structure and re-productive isolation among lineages of Fusarium graminearum, the fungus causing wheat scab. Proc. Natl. Acad. Sci. U. S. A. 97: 7905-7910.

O'Donnell, K., Sutton, D. A., Rinaldi, M. G., Sarver, B. A. J., Balajee, S. A., Schroers, H. J. et al. 2010. Internet-accessible DNA sequence database for identifying fusaria from human and animal infections. J. Clin. Microbiol. 48: 3708-3718.

O'Donnell, K., Ward, T. J., Geiser, D. M., Kistler, H. C. and Aoki, T. 2004. Genealogical concordance between the mating type locus and seven other nuclear genes supports formal recognition of nine phylogenetically distinct species within the Fusarium graminearum clade. Fungal Genet. Biol. 41: 600-623.

O'Donnell, K., Ward, T. J., Robert, V. A. R. G., Crous, P. W., Geiser, D. M. and Kang, S. 2015. DNA sequence-based identification of Fusarium: current status and future directions. Phytoparasitica 43: 583-595.

O'Donnell, K., Whitaker, B. K., Laraba, I., Proctor, R. H., Brown, D. W., Broders, K. et al. 2022. DNA sequence-based identification of Fusarium: a work in progress. Plant Dis. 106: 1597-1609.

Ok, H. E., Kim, D. M., Kim, D., Chung, S. H., Chung, M. S., Park, K. H. et al. 2014. Mycobiota and natural occurrence of aflatoxin, deoxynivalenol, nivalenol and zearalenone in rice freshly harvested in South Korea. Food Control 37: 284-291.

Reeb, V., Lutzoni, F. and Roux, C. 2004. Contribution of RPB2 to multi-locus phylogenetic studies of the euascomycetes (Pezizomycotina, Fungi) with special emphasis on the lichen-forming Acarosporaceae and evolution of polyspory. Mol. Phylogenet. Evol. 32: 1036-1060.

Ryu, J. G., Lee, S., Lee, S. H., Son, S. W., Nam, Y. J., Kim, M. et al. 2011. Natural occurrence of Fusarium head blight and its mycotoxins in 2010 harvested barley and wheat grains in Korea. Res. Plant. Dis. 17: 272-279. (In Korean).

Seo, Y. S., Seo, J. A., Sohn, H. B. and Lee, Y. W. 1998. Production of 8-ketotrichothecenes by Fusarium gramineaerum on corn and barley. Korean J. Plant Pathol. 14: 418-424.

Starkey, D. E., Ward, T. J., Aoki, T., Gale, L. R., Kistler, H. C., Geiser, D. M. et al. 2007. Global molecular surveillance reveals novel Fusarium head blight species and trichothecene toxin diversity. Fungal Genet. Biol. 44: 1191-1204.

Summerell, B. A. 2019. Resolving Fusarium: current status of the genus. Annu. Rev. Phytopathol. 57: 323-339.