Res. Plant Dis > Volume 29(2); 2023 > Article
국내에서 분리된 Fusarium sambucinum 종복합체 균주의 재동정 및 문헌 고찰

요 약

Fusarium sambucinum 종 복합체는 식물에 심각한 질병을 일으키는 분류군이다. 국내에서는 F. sambucinum 종 복합체가 일으키는 식물병에 대한 많은 연구가 보고되었으나, 한국식물병명목록에는 2종(F. graminearum, F. sambucinum)이 14개의 기주에 식물병을 일으키는 정보만이 등록되어 있다. F. sambucinum 종복합체의 다양성 및 병원성을 확인하기 위해 농업미생물은행(Korean Agricultural Culture Collection)에 보존된 57균주의 F. sambucinum 종 복합체를 다중 유전자 염기서열 분석(multi-locus sequence typing)을 바탕으로 7종(F. asiaticum, F. graminearum, F. vorosii, F. meridionale, F. bootii, F. kyushuense, F. armeniacum)으로 재동정하였다. 이전의 보고와 이번 연구의 결과에 따라, F. sambucinum 종 복합체 중 5종(F. asiatum, F. graminearum, F. vorosii, F. armeniacum, F. sambucinum)이 24개의 기주에 병원성을 보였으며, 3종(F. meridionale, F. bootii, F. kyushuense)의 병원성은 명확하지 않았다.

ABSTRACT

Fusarium sambucinum species complex (FSAMSC) is an important taxonomic group, causing severe plant diseases. Many studies were carried out on FSAMSC plant diseases in Korea, but only 2 species (F. graminearum, F. sambucinum) from 14 host plants were registered in the List of Plant Disease in Korea. To clarify FSAMSC diversity and their pathogenecity, we examined FSAMSC isolates preserved in the Korean Agricultural Culture Collection. Fifty-seven strains were reidentifed as 7 species (F. asiaticum, F. graminearum, F. vorosii, F. meridionale, F. boothii, F. kyushuense, F. armeniacum) based on multi-locus sequence typing analysis. According to previous reports and result of this study, 5 species (F. asiaticum, F. graminearum, F. vorosii, F. armeniacum, F. sambucinum) were pathogenic on 24 host plants in FSAMSC, while the pathogenicity of 3 species (F. meridionale, F. boothii, F. kyushuense) were not clear.

서 론

Fusarium은 작물에 광범위한 질병을 일으키는 식물 병원성 곰팡이 중 하나이다(Summerell, 2019). 대표적으로 Fusarium 은 시들음병, 뿌리, 줄기 및 속 썩음병, 묘목의 역병, 구근 및 괴경의 썩음병을 유발하며, 일부 종은 진균독소를 생성하여 이삭 썩음병, 붉은곰팡이병, 줄기썩음병을 일으킨다(Bahadur, 2022).
Fusarium sambucinum 종복합체는 농업 환경에 가장 해로운 영향을 미치는, 붉은곰팡이병의 주요 병원체인 Graminearum clade를 포함하고 있기에 그 중요성은 더욱 크다(Goswami와 Kistler, 2004). 우리나라에서는 1963년 붉은곰팡이병으로 인해 남부지방에 80-100%의 손실이 발생된 적이 있었으며 이후에도 1974년, 1990년, 1998년에 주기적인 수율 감소로 경제적 손실이 있었다(Ryu 등, 2011). 농업 생태계에서 F. sambucinum 종복합체의 다양한 종이 상당히 큰 경제적 피해를 일으키기에 지속적인 연구를 통한 예방이 필요하다.
계통학적 종 인식(genealogical concordance phylogenetic species recognition)에 따르면, Fusarium은 23개의 종복합체로 구성되며 400개 이상의 종을 포함하고 있다(O’ Donnell 등, 2015, 2022). 그 중, F. sambucinum 종복합체는 가장 많은 종을 포함하며 진균독소를 생성하는 특성으로 인해 식물병리학자와 진균독성학자에게 큰 관심을 끌고 있다(Laraba 등, 2021; O’ Donnell 등, 2022).
우리나라에서도 많은 연구자들에 의해 F. sambucinum 종복합체가 일으키는 식물병이 보고되어 있으며, 분리된 균주의 일부는 농업미생물은행(Korean Agricultural Culture Collection, KACC)에 보관되어져 있다. 이에 따라, 국내에서 분리된 Fusarium 종의 확인을 위해, KACC에 2000년대 초반부터 장기 보존되어 있는 F. sambucinum 종복합체 균주를 최신 분류체계(Crous 등, 2021)에 맞게 재동정하여 확인하였다. F. sambucinum 종복합체를 동정하는데 필요한 분류체계는 단일 유전자의 사용이 아닌 다중 유전자를 사용한 분석이 이루어지고 있기에, 3개의 단백질 코딩 유전자인 translation elongation factor 1-α (tef1), RNA polymerase second largest subunit (rpb2) 및 RNA polymerase largest subunit (rpb1)을 사용하여 분석하였다(Crous 등, 2021).
국내 식물병의 정보를 확인할 수 있는 한국식물병명목록의 기록과 KACC 균주의 재동정 결과를 비교하였을 때 한국식물병명목록에는 많은 종이 반영되어 있지 않았다. 일부 종들은 보고는 되어 있으나, 한국식물병명목록에 등록되지 않고 KACC 에도 균주가 기탁되지 않은 것으로 판단되어, 국내에서 보고된 문헌을 추가로 조사하여 정리하였다.
본 연구에서는 국내에서 분리되어 KACC에 보존되어 있는 F. sambucinum 종복합체 균주를 재동정하고, 국내에서 보고된 문헌을 고찰하여, F. sambucinum 종복합체의 국내 병 발생 현황을 한국식물병명목록에 반영하고자 하였다.

재료 및 방법

균주 수집

KACC에 2000년부터 보관 중인 국내에서 분리된 F. sambucinum 종복합체 균주를 사용하였다(Table 1). -196° C, 10% 글리세롤(glycerol)에 보관된 균주는 potato dextrose agar (PDA) 배지와 malt extract agar (MEA) 배지에 25° C, 암조건에서 4-7일간 배양하였다.
Table 1.
Fusarium sambucinum species complex strains used in this study
Species name Straina Country Host/Habitat Name by depositorb Isolated date Ref.c Accession no.d
tef1 rpb2 rpb1
F. acaciae-mearnsii NRRL 26755 South Africa Australian acacia - MW233086.1 MW233429.1 MW233257.1
F. aethiopicum NRRL 46726 T Ethiopia Triticum aestivum - FJ240298 MW233470 MW233298
F. armeniacum FRC R-9335 T Australia Triticum aestivum - GQ915501 GQ915485 KT597715
KACC 43804 Korea Soil F. sporotrichioides* May 2007 - RDA0061580 RDA0061578 RDA0061579
KACC 43805 Korea Soil F. sporotrichioides* May 2007 - RDA0061581 RDA0061583 RDA0061582
F. asiaticum NRRL 13818 T Japan Hordeum vulgare - AF212451 JX171573 JX171459
KACC 48824 Korea Avena sativa F. asiaticum Jun 2018 1 RDA0060921 RDA0061433 RDA0061434
KACC 48825 Korea Avena sativa F. asiaticum Jun 2018 1 RDA0060922 RDA0061431 RDA0061432
KACC 48826 Korea Avena sativa F. asiaticum Jun 2018 1 RDA0061428 RDA0061429 RDA0061430
KACC 47024 Korea Coix lacryma-jobi F. asiaticum Oct 2012 - RDA0060917 RDA0061445 RDA0061444
KACC 41040 Korea Hordeum vulgare F. graminearum* Jan 2011 3 RDA0061575 RDA0061577 RDA0061576
KACC 41042 Korea Hordeum vulgare F. graminearum* Jun 2000 - RDA0061572 RDA0061574 RDA0061573
KACC 46510 Korea Meju (Oryza sativa) F. asiaticum Jan 2011 - RDA0061453 RDA0061454 RDA0061455
KACC 46511 Korea Meju (Oryza sativa) F. asiaticum Jan 2011 - RDA0061458 RDA0061457 RDA0061456
KACC 46512 Korea Meju (Oryza sativa) F. asiaticum Jan 2011 - RDA0061461 RDA0061460 RDA0061459
KACC 46513 Korea Meju (Oryza sativa) F. asiaticum Jan 2011 - RDA0061464 RDA0061463 RDA0061462
KACC 46514 Korea Meju (Oryza sativa) F. asiaticum Jan 2011 - RDA0060913 RDA0061466 RDA0061465
KACC 46428 Korea Oryza sativa F. asiaticum Nov 2010 4 RDA0060912 RDA0061468 RDA0061467
KACC 46429 Korea Oryza sativa F. asiaticum Nov 2010 4 RDA0060911 RDA0061470 RDA0061469
KACC 46430 Korea Oryza sativa F. asiaticum Nov 2010 - RDA0060910 RDA0061472 RDA0061471
KACC 46577 Korea Oryza sativa F. graminearum* May 2009 - RDA0061565 RDA0061564 RDA0061563
KACC 46886 Korea Oryza sativa F. asiaticum Nov 2010 - RDA0060916 RDA0061450 RDA0061449
KACC 46887 Korea Oryza sativa F. asiaticum Nov 2010 - RDA0060915 RDA0061452 RDA0061451
KACC 47319 Korea Oryza sativa F. asiaticum Jan 2012 5 RDA0061443 RDA0061442 RDA0061602
KACC 47495 Korea Oryza sativa F. graminearum* Apr 2012 - RDA0061547 RDA0061549 RDA0061548
KACC 48483 Korea Oryza sativa F. asiaticum Oct 2015 - RDA0060919 RDA0061438 RDA0061437
KACC 48484 Korea Oryza sativa F. asiaticum Oct 2015 - RDA0060918 RDA0061440 RDA0061439
KACC 47025 Korea Peucedanum japonicum F. asiaticum Jul 2012 - RDA0061446 RDA0061447 RDA0061448
KACC 48819 Korea Sorghum bicolor F. asiaticum Sep 2018 2 RDA0060920 RDA0061436 RDA0061435
KACC 47496 Korea Triticum aestivum F. graminearum* Aug 2012 - RDA0061552 RDA0061551 RDA0061550
KACC 47498 Korea Triticum aestivum F. graminearum* Aug 2012 - RDA0061558 RDA0061557 RDA0061559
KACC 47499 Korea Triticum aestivum F. graminearum* Aug 2012 - RDA0061560 RDA0061562 RDA0061561
KACC 43800 Korea Wood tie F. culmorum* Nov 2007 - RDA0061541 RDA0061543 RDA0061542
KACC 41046 Korea Zea mays F. graminearum* Jun 2000 - RDA0061571 RDA0061570 RDA0061569
KACC 47497 Korea Zea mays F. graminearum* Oct 2012 - RDA0061553 RDA0061555 RDA0061554
KACC 42099 Korea Zoysia japonica F. culmorum* Jun 2004 - RDA0061546 RDA0061545 RDA0061544
F. austroamericanum NRRL 28585 Brazil Herbaceous vine - MW233095.1 MW233438.1 MW233266.1
F. boothii NRRL 26916 T South Africa Zea mays - GQ915503 KM361659 KM361641
KACC 41047 Korea Zea mays F. graminearum* Jun 2000 - RDA0061566 RDA0061568 RDA0061567
KACC 46431 Korea Zea mays F. boothii Sep 2009 - RDA0060909 RDA0061474 RDA0061473
KACC 46432 Korea Zea mays F. boothii Oct 2010 - RDA0060908 RDA0061476 RDA0061475
F. brachygibbosum NRRL 20954 T India Sorghum vulgare - MW233075 MW233418 MW233246
F. brasilicum NRRL 31238 Brazil Barley - MW233104.1 MW233448.1 MW233276.1
F. cortaderiae NRRL 29297 T New Zealand Cortaderia selloana - AY225885 KM361662 KM361644
F. culmorum NRRL 25475 ET Denmark Hordeum vulgare - MW233082 JX171628 JX171515
F. dactylidis NRRL 29298 T New Zealand Dactylis glomerata - DQ459748 KM361672 KM361654
F. gerlachii NRRL 36905 T USA Triticum aestivum - DQ459742 KM361664 KM361646
F. goolgardi RBG 5411 T Australia Xanthorrhoea glauca - KP101123 KP083280 KP083270
F. graminearum CBS 136009 ET Germany Hordeum vulgare - MW928838 MW928826 MW928810
KACC 48828 Korea Avena sativa F. graminearum Jun 2018 1 RDA0061479 RDA0061478 RDA0061480
KACC 47026 Korea Coix lacryma-jobi F. graminearum Jul 2012 - RDA0061484 RDA0061485 RDA0061486
KACC 46437 Korea Hordeum vulgare F. graminearum Sep 2010 - RDA0061496 RDA0061497 RDA0061498
KACC 46438 Korea Hordeum vulgare F. graminearum Sep 2010 - RDA0061501 RDA0061500 RDA0061499
KACC 46439 Korea Hordeum vulgare F. graminearum Sep 2010 - RDA0061504 RDA0061503 RDA0061502
KACC 46434 Korea Oryza sativa F. graminearum Nov 2010 - RDA0061487 RDA0061488 RDA0061489
KACC 46441 Korea Oryza sativa F. graminearum Nov 2010 - RDA0061507 RDA0061506 RDA0061505
KACC 48818 Korea Sorghum bicolor F. graminearum Sep 2018 2 RDA0061483 RDA0061482 RDA0061481
KACC 46442 Korea Triticum aestivum F. graminearum Sep 2010 - RDA0061510 RDA0061509 RDA0061508
KACC 41044 Korea Zea mays F. graminearum Jun 2000 3 RDA0061513 RDA0061512 RDA0061511
KACC 46435 Korea Zea mays F. graminearum Nov 2010 - RDA0061492 RDA0061491 RDA0061490
KACC 46436 Korea Zea mays F. graminearum Nov 2010 - RDA0061493 RDA0061494 RDA0061495
F. kyushuense MRC 1767 T Japan Seed of Triticum aestivum - MH582292 MH582098 MW233227.1
KACC 47023 Korea Coix lacryma-jobi F. kyushuense Jul 2012 - RDA0061540 RDA0061539 RDA0061538
F. langsethiae CBS 113234 T Norway Kernal of Avena sativa - AB674298 MW928828 MW928812
F. longipes NRRL 20695 NT USA Soil - GQ915509 GQ915493 MW233244
F. louisianense NRRL 54197 T USA Seeds of Triticum sp. - KM889633 KM889657 KM889655
F. lunulosporum NRRL 13393 T South Africa Citrus paradisi - AF212467 KM361655 KM361637
F. meridionale NRRL 28436 T New Caledonia Citrus sinensis - AF212435 KM361660 KM361642
KACC 48425 Korea Zea mays F. meridionale Nov 2010 - RDA0061514 RDA0061515 RDA0061516
KACC 46433 Korea Zea mays F. meridionale Nov 2010 - RDA0061517 RDA0061518 RDA0061519
KACC 46440 Korea Zea mays F. meridionale Nov 2010 - RDA0061522 RDA0061521 RDA0061520
F. mesoamericanum NRRL 25797 T Honduras Musa sp. - AF212441 KM361657 KM361639
F. musarum NRRL 28507 T Panama Musa sapientum - MW233094 MW928829 MW233265
F. nepalense NRRL 54222 T Nepal Oryza sativa - KM889631 KM361668 KM361650
F. nodosum CBS 201.63 T Portugal Seed of Arachis hypogaea - MN120763 MN120743 MN120725
F. palustre NRRL 54056 T USA Spartina alterniflora - GQ856941 KT597731 KT597718
F. poae LC 6917 China Oryza sativa - MW620088.1 MW474613.1 MW024655.1
F. praegraminearum NRRL 39664 T New Zealand Litter in maize paddock - KX260120 KX260126 KX260125
F. pseudograminearum NRRL 28062 T Australia Hordeum vulgare - AF212468 JX171637 JX171524
F. robustum NRRL 13392 T Argentina Araucaria angustifolia - MW233062.1 MW233405.1 MW233233.1
F. sibiricum NRRL 53430 T Russia Grain of Avena sativa - HM744684 HQ154472 MW233302
F. subtropicale NRRL 66764 T Brazil Hordeum vulgare - MH706974 MH706973 MH706972
F. transvaalense LC 13784 USA Medicago sativa - MW620089 MW474614 MW024656
F. ussurianum NRRL 45681 T Russia Seed of Avena sativa - FJ240301 KM361666 KM361648
F. venenatum NRRL 26228 T Austria Culm of Triticum aestivum - MW233085.1 MW233428.1 MW233256.1
F. vorosii NRRL 37605 T Hungary Spikelet of Triticum aestivum - DQ459745 KM361665 KM361647
KACC 48006 Korea Hordeum vulgare F. vorosii Jan 2011 6 RDA0061532 RDA0061533 RDA0061534
KACC 46885 Korea Oryza sativa F. vorosii Oct 2010 7 RDA0061535 RDA0061536 RDA0061537
KACC 48820 Korea Sorghum bicolor F. vorosii Sep 2018 2 RDA0061526 RDA0061527 RDA0061528
KACC 48829 Korea Sorghum bicolor F. vorosii Sep 2018 1, 2 RDA0061523 RDA0061524 RDA0061525
KACC 46443 Korea Zea mays F. asiaticum* Nov 2010 - RDA0061605 RDA0061603 RDA0061604
  KACC 48005 Korea Zea mays F. vorosii Jan 2010 6 RDA0061531 RDA0061530 RDA0061529

Sequences generated at GenBank are shown in bold. RDA numbers are available on the KACC website (http://genebank.rda.go.kr). Other accession numbers are available on th NCBI website.

a CBS: Westerdijk Fungal Biodiverity Institute (WI), Utrecht, The Netherlands; FRC: Fusarium Research Center, Pennsylvannia State University, PA; KACC: Korean Agricultural Cultur Collection, Agricultural Microbiology Division, Korea; LC: State Key Laboratory of Mycology, Institute of Microbiology, ChineseAcademy of Sciences, Beijing 100101, P. R. China NRRL: Agricultural Research Service Culture Collection, National Center for Agricultural Utilization Research, USDA, Peoria, IL, USA; MRC: Agricultural Research Council, Pretoria South Africa; RBG: Royal Botanic Gardens Trust, Sydney, New South Wales, Australia. ET: ex-epitype; NT: ex-neotype; T: ex-type.

b Asterisks indicate strains which had scientific name change by re-identification.

d tef1, translation elongation factor 1-alpha; rpb2, RNA polymerase second largest subunit; rpb1, RNA polymerase largest subunit.

DNA 추출, polymerase chain reaction, 염기서열 분석

Genomic DNA 추출을 위한 균사체를 수집하기 위해 각 균주를 MEA 배지에 접종하고, 25° C, 암조건에서 4-7일간 배양하였다. DNeasy Plant Mini Kit (Qiagen, Hilden, Germany)의 이용 메뉴얼에 따라 전체 genomic DNA를 추출하였다. DNA 염기서열 분석은 tef1, rpb1rpb2의 부위를 대상으로 실시하였다. Polymerase chain reaction 증폭은 각각 EF1/EF2, F7/F8, 5f2/11ar 프라이머 쌍을 사용하였다(Table 2). 증폭된 샘플들은 동일한 프라이머 쌍을 사용하여 Macrogen (Seoul, Korea)에 염기서열 분석을 진행하였다.
Table 2.
Primer information for DNA amplification of Fusarium sambucinum species complex
Locus Primer Sequence (5’→3’) Annealing temperature (°C) References
tef1 EF-1 ATGGGTAAGGARGACAAGAC 55 O′ Donnell et al. (1998)
EF-2 GGARGTACCAGTSATCATGTT O′ Donnell et al. (1998)
rpb2 RPB2-5f2 GGGGWGAYCAGAAGAAGGC 58 Reeb et al. (2004)
RPB2-11ar GCRTGGATCTTRTCRTCSACC Liu et al. (1999)
rpb1 F7 CRACACAGAAGAGTTTGAAGG 64 O′ Donnell et al. (2010)
R8 CAATGAGACCTTCTCGACCAGC O′ Donnell et al. (2010)

tef1, translation elongation factor 1-alpha; rpb2, RNA polymerase second largest subunit; rpb1, RNA polymerase largest subunit.

계통도 분석

분석된 염기서열은 DNASTAR Seqman II (DNASTAR, Madison, WI, USA)를 사용하여 편집하였다. F. sambucinum 종복합체에 속하는 표준 및 참조 균주는 NCBI GenBank database에서 얻었다. 편집된 염기서열은 MEGA version 7의 Clustal W를 사용하여 정렬하였고, 계통도는 maximum likelihood (ML)를 사용하여 분석하였다(Kumar 등, 2016). 개별 유전자 데이터는 1,000번의 bootstrap을 사용하여 분석되었다. 개별 유전자의 계통학적 분석을 수행한 다음 tef1, rpb2, rpb1 3가지 유전자 서열을 결합하여 분석하였다. 베이즈 정보 기준, 최적의 모델인 TN93+G를 사용하여 3가지 유전자가 결합된 계통도의 분석을 진행하였다.

결과 및 고찰

농업미생물은행(KACC)에서 보존하고 있는, 국내에서 분리된 57개의 균주를 tef1, rpb2, rpb1 유전자를 사용하여 재동정하였다(Fig. 1). ML 분석 결과, KACC 균주는 총 3 clade 및 7종으로 동정되었다. Graminearum clade (n=54)에서는 총 5종인 F. asisaticum (30), F. vorosii (6), F. boothii (3), F. meridionale (3), F. graminearum (12)으로, Sambucinum clade (2)에는 F. armeniacum (2), Sporotrichioides clade (1)에는 F. kyushuense (1)를 확인하였다.
Fig. 1.
The distribution of Fusarium sambucinum species complex in KACC. The tree was constructed by the Maximum Likelihood method based on TN93+G model using tef1, rpb1, and rpb2. Clade support was inferred from 1,000 bootstrap replicates and indicated values exceed 50%. Clade names are indicated on the right of the tree. Additional substrate information was indicated with circle in color represented on the left. Re-identified species from KACC strains are marked with bold. The tree was rooted on sequence of NRRL 25331 F. circinatum from the F. fujikuroi species complex. tef1, translation elongation factor 1-alpha; rpb2, RNA polymerase second largest subunit; rpb1, RNA polymerase largest subunit.
RPD-2023-29-2-118f1.jpg
KACC 균주가 활용된 문헌은 표에 정리하였으나(Table 1), 그 정보가 부족하여 한국식물병명목록에서의 기록을 확인하였다. 한국식물병명목록에는 14개의 기주를 대상으로 식물병을 일으키는 2종(F. graminearumF. sambucinum)이 등록되어 있다. 한국식물병명목록에는 많은 정보가 누락되어 있어, KACC가 보유하고 있는 F. sambucinum 종복합체 균주의 정보와 국내에 보고된 Fusairum의 문헌을 비교하여 정리하였다(Table 3).
Table 3.
Comparison of host plants of Fusarium species among KACC strains, previous reports, and List of Plant Diseases in Korea
No. Species KACC strains Previous reports List of Plant Diseases in Korea
1 F. armeniacum   Coix lacryma-jobi (An et al., 2015)a
Glycine max (Jang et al., 2022)b
Oryza sativa (Hong et al., 2015)a
2 F. asiaticum Avena sativab Avena sativa (Choi et al., 2019a)b
Coix lacryma-jobia Coix lacryma-jobi (An et al., 2015)a
Hordeum vulgarea Hordeum vulgare (Jang et al., 2019)b
Oryza sativaa Oryza sativa (Jang et al., 2019)b
Panicum miliaceum (Choi et al., 2021)a
Peucedanum japonicuma
Triticum aestivuma Triticum aestivum (Jang et al., 2019)b
Zea maysa Zea mays (Jang et al., 2019)b
Zoysia japonicaa  
3 F. boothii Zea maysa Zea mays (Lee et al., 2012)a  
4 F. graminearum Avena sativab Avena sativa (Choi et al., 2019a)b
Coix lacryma-jobia Coix lacryma-jobi (An et al., 2015)a
Cucumis melo (Kim and Kim, 2004)b Cucumis melob
Dianthus caryophyllus (Han et al., 2001)b Dianthus caryophyllusb
Glycine max (Kang et al., 2020)b Glycine maxb
Hordeum vulgarea Hordeum vulgare (Seo et al., 1998)b Hordeum vulgareb
Ipomoea batatasb
Lolium perenneb
Larix kaempferib
Phleum pratenseb
Oryza sativaa Oryza sativa (Lee et al., 2009)b Oryza sativab
Panicum miliaceum (Choi et al., 2021)a
Pinus koraiensisb
Sorghum bicolor (Choi et al., 2013)b Sorghum bicolorb
Triticum aestivuma Triticum aestivumb
Zea maysa Zea mays (Seo et al., 1998)b Zea maysb
5 F. kyushuense Coix lacryma-jobia Coix lacryma-jobi (An et al., 2015)a
Panicum miliaceum (Choi et al., 2021)a
Oryza sativa (Ok et al., 2014)a
6 F. meridionale Zea maysa Zea mays (Lee et al., 2012)a
7 F. sambucinum   Cucumis melo (Kim and Kim, 2004)b Cucumis melob
8 F. vorosii Hordeum vulgareb Hordeum vulgare (Lee et al., 2016)b
Oryza sativaa Oryza sativa (Lee et al., 2016)b
Zea maysb Zea mays (Lee et al., 2016)b

a Pathogenicity on host was not tested.

b Pathogenicity on host was confirmed.

F. armeniacum & F. sambucinum

F. armeniacum은 1993년에 F. acuminautm subsp. armeniacum으로 호주, 미국, 남아프리카에서 분리되어 보고되었다(Burgess 등, 1993). 그 후, 2000년에 random amplified polymorphic DNA 분석을 통해 F. armeniaucum은 종의 지위를 부여받았다(Burgess와 Summerell, 2000).
국내에서는 콩(Glycine max)에 뿌리썩음병을 일으키는 F. armeniacum이 보고되었다(Jang 등, 2022). 벼(Oryza sativa) (Hong 등, 2015), 율무(Coix lacryma-jobi) 종자(An 등, 2015)에서 분리된 F. armeniacum이 논문에 사용되었으나 병원성에 대한 결과가 없기에 한국식물병명목록에 등록하기 위해서는 병원성 실험이 필요하다(Table 3). 흙에서 분리되어 2007년에 기탁된 KACC 43804, KACC 43805는 형태적 특징에 의하여 F. sporotrichioides로 동정된 후에 분자적 분석의 결과로 F. armeniacum으로 재동정되었다(Table 1, Fig. 1).
F. armeniacum과 같은 Sambucinum clade에 포함되는 F. sambucinum은 참외(Cucumis melo)에 열매썩음병을 일으키는 것으로 보고되었으나(Kim과 Kim, 2004), 농업미생물은행에는 해당 종의 균주가 보존되어 있지 않다.
위의 내용을 종합할 때에 Sambucinum clade에는 콩에서 분리된 F. armeniacum과 참외에서 분리된 F. sambucinum의 병원성이 확인되었고 그 외의 벼와 율무에서 분리된 F. armeniacum은 병원성 확인이 필요하다(Table 3).

F. asiaticum

F. asiaticum은 아시아 지역(중국, 네팔, 일본, 한국)과 남아메리카(브라질) 지역에 분포되어 있으며(O’ Donnell 등, 2004), 2000년에 7개의 계통으로 나뉘어 Fg (Fusairum graminearum) clade 내에서 계통번호인 lineage 6으로 최초 보고되었다(O’ Donnell 등, 2000). 그리고 2004년에 계통발생학적 분석을 통해 Fg clade내의 명명되지 않은 종을 F. asiaticum으로 보고하였다(O’ Donnell 등, 2004).
국내에서는 벼과의 다양한 기주인 귀리(Avena sativa) (Choi 등, 2019a), 밀(Triticum aestivum) (Jang 등, 2019), 벼(Jang 등, 2019), 보리(Hordeum vulgare) (Jang 등, 2019), 옥수수(Zea mays) (Jang 등, 2019)에서 붉은곰팡이병이 보고되었다. 하지만 수수(Sorghum bicolor) (Choi 등, 2019b)와 콩(Choi 등, 2020)에서의 분리된 F. asiaticum은 병원성이 없는 것으로 보고되었다. 기장(Panicum miliaceum) (Choi 등, 2021)과 율무(An 등, 2015)에서 분리된 F. asiaticum은 병원성에 관한 정보가 없기에 확인이 필요하다(Table 3).
KACC에는 귀리(Choi 등, 2019a)에서 분리한 KACC 48824 (P4), KACC 48825 (P8), KACC 48826 (P14), 벼에서 분리한(Kim 등, 2012) KACC 46428 (ESR3R6)와 KACC 46429 (ASR1R2), 보리에서 분리한(Lee 등, 2001) KACC 41040 (88-1), 볏짚에서 분리된(Kim 등, 2013) KACC 47319, 수수에서 분리한(Choi 등, 2019b) KACC 48819 (S45) 균주를 보관 중이다. 또한, 보고는 없으나 밀, 옥수수, 율무, 갯기름나물(Peucedanum japonicum), 잔디(Zoysia japonica)에서 분리한 균주를 보관 중이다(Table 1).
F. asiaticum으로 보관 중인 균주 중, 9균주는 F. gramin-iarum 으로 그리고 2균주는 F. culmorum 으로 기탁되었으나 본 실험에서 F. asiaticum으로 재동정되었다(Table 1). 2004년 이전에 기탁된 균주들은 F. asiaticum의 종명을 부여 받기 이전이었고 2004년 이후에 기탁된 것은 분자적 분석 없이 형태적 특징으로만 보관되었기 때문이다.
현재까지 한국식물병명목록에는 F. asiaticum이 기록되어 있지 않기에 위의 결과를 바탕으로 귀리(Choi 등, 2019a), 밀(Jang 등, 2019), 벼(Jang 등, 2019), 보리(Jang 등, 2019), 옥수수(Jang 등, 2019)에 붉은곰팡이병을 일으키는 F. asiaticum을 추가해야 한다.

F. boothii

F. boothii는 남아프리카에 분포되어, 2000년에 Fg clade의 lineage 3으로 처음 언급되고(O’ Donnell 등, 2000), 2004년에 계통발생학적 분석을 통해 종명인 F. boothii로 보고되었다(O’ Donnell 등, 2004).
국내에서는 2012년에 옥수수에서 분리하여 계통 간의 관계를 강조하기 위해 종명 대신 계통 번호인 lineage 3으로 논문에 사용되었다(Lee 등, 2012). 그러나 이 균주는 옥수수에서 분리는 되었으나, 병원성에 대한 정보는 없어 감염 여부의 확인이 필요하다. 이 균주는 현재 KACC에서 보관 중이지 않지만, 옥수수에서 분리한 다른 균주를 보관 중이다.
보관 균주 중, KACC 41047은 2000년도 당시 형태적 분석으로만 진행되어 F. graminearum으로 보존되었고 분자적 분석을 통해 F. boothii로 학명을 변경하였다(Table 1).
F. boothii의 식물병을 일으키는 정보가 없기에, KACC에 보존되어 있는 F. boothii 균주를 활용하여 병원성 실험을 진행할 필요성이 있다.

F. graminearum

F. graminearumGraminearum clade (Fg clade) 내에서 많은 종의 분화로 변화해왔다. 6개의 단일 유전자 서열을 이용하여 7개의 계통군으로(O’ Donnell 등, 2000), MAT 유전자 및 11개의 추가 유전자를 통해 명명되지 않은 종에 대해 보고되었다(O’ Donnell 등, 2004).
F. graminearum은 벼과 식물의 병원균으로써 세계적으로 알려져 있다. 특히 따뜻한 지역의 벼와 옥수수, 온대지역의 귀리, 보리, 잔디, 호밀(Secale cereale)에서 많이 발생되며(Ger-lach와 Nirenberg, 1982), 벼과 이외에도 애기장대(Arabidopsis thaliana) (Nalam 등, 2015), 콩(Broders 등, 2007) 등에서 병을 일으킨다고 보고되었다.
국내에서는 귀리(Choi 등, 2019a), 벼(Lee 등, 2009), 보리(Seo등, 1998)에 붉은곰팡이병, 수수(Choi 등, 2013)에 이삭곰팡이병, 옥수수(Seo 등, 1998)에 이삭썩음병, 참외(Kim과 Kim, 2004)에 열매썩음병, 카네이션(Dianthus caryophyllus) (Han 등, 2001)에 모마름병, 콩(Kang 등, 2020)에 뿌리 및 줄기 썩음병을 일으킨다는 보고가 있다. 추가로 한국식물병명목록에는, 고구마(Ipomoea batatas)에 밑썩음병, 밀, 호밀풀(Lolium perenne), 큰조아재비(Pinus koraiensis)에 붉은곰팡이병, 일본잎갈나무(Larix kaempferi)와 잣나무(Pinus koraiensis)에 모잘록병을 일으킨다는 정보를 확인할 수 있다(Table 3). 기장(Choi 등, 2021) 및 율무(An 등, 2015)에서의 분리는 보고되었으나, 병원성 확인이 필요하다.
KACC에서는 현재 귀리(Choi 등, 2019a)에서 분리한 KACC 48828 (O517), 수수(Choi 등, 2019b)에서 분리한 KACC 48818 (S1159), 옥수수(Lee 등, 2001)에서 분리한 KACC 41044 (H-11) 및 밀, 벼, 보리, 율무에서 분리한 균주를 보관 중이다(Table 1).한국식물병명목록에는 귀리(Choi 등, 2019a)에 붉은곰팡이병을 일으키는 식물병 정보를 추가해야 한다.

F. kyushuense

F. kyushuense는 처음에는 F. sporotrichioides로 혼돈되었지만, 후벽포자(chlamydospore)를 생성하지 않는 형태적 특징의 차이가 있으며 F. arthrosporioides와도 유사하지만 분생포자의 발생에 차이가 있는 종이다. F. kyushuense 는 1998년도에 일본 큐슈 지역의 밀과 시코쿠 지역에서의 비닐 플레이트(vinyl plate)에서 분리되어 보고되었다(Aoki와 O’ Donnell, 1998).
국내에서는 병원성 실험 없이 분리원에 대한 보고로 기장(Choi 등, 2021), 벼(Ok 등, 2014), 율무 종자(An 등, 2015)의 보고가 있다. 이 문헌에서 활용된 균주는 현재 KACC에서 보관 중이지 않고, 2012년에 율무에서 분리한 다른 균주를 보관 중이다(Table 1).
현재까지 국내에 F. kyushuense가 일으키는 식물병에 대한 정보가 없고, KACC에서도 1개의 균주만 보존하고 있기에 균주 확보를 위한 분리 및 병원성 실험이 필요하다.

F. meridionale

F. meridionale는 2000년에 lineage 2로 처음 보고되어(O’ Donnell 등, 2000), 2004년에 종명이 확정되었다(O’ Donnell 등, 2004).
국내에서는 2012년도에 옥수수에서 분리한 F. meridionale를 계통 번호인 lineage 2로 논문에 사용하였다(Lee 등, 2012). 그러나 옥수수에서 분리한 F. meridionale의 병원성 여부는 알려지지 않은 상태이다. 위 문헌에서 사용된 균주는 현재 KACC에서 보관 중이지 않고, 옥수수에서 분리한 다른 균주를 보관 중이다(Table 1). 이에 따라, KACC에서 보존 중인 균주를 활용해 병원성 실험을 진행 한 뒤 한국식물병명목록에 추가로 등록하는 과정이 필요하다.

F. vorosii

F. vorosii는 일본과 헝가리의 밀에서 분리되었으며, 2007년에 붉은곰팡이병의 분리주를 식별하는 과정에서 최초로 보고되었다(Starkey 등, 2007). 국내에서는 2016년에 벼, 보리에서 붉은곰팡이병을, 옥수수에서 이삭썩음병 및 밑둥썩음병의 발생이 확인되었다(Lee 등, 2016). 수수에서 분리한 F. vorosii도 있으나, 이는 수수에 병원성이 나타나지 않는 것으로 보고되었다(Choi 등, 2019b).
KACC에서는 문헌으로도 사용되어진, 벼에서 분리한(Kim 등, 2016) KACC 46885 (GWR12R1), 보리에서 분리한(Lee 등, 2016) KACC 48006 (#195), 수수 알곡에서 분리한(Choi 등, 2019b) KACC 48820 (S1620)과 KACC 48829 (S33), 옥수수에서 분리한(Lee 등, 2016) KACC 48005 (GWS)를 보관 중이다.
KACC에 보존된 F. vorosii 균주 중 문헌으로 보고되지 않은, KACC 46443은 tef1, rpb2를 이용한 분자적 분석 방법으로 2010년에 기탁되었지만 기탁자가 당시 참고했던 문헌(O’ Donnell 등, 2000)으로 인해 F. asiaticum으로 보존되어 왔고 이번 연구를 통해 재동정되었다.
따라서, 한국식물병명목록에는 벼와 보리에 붉음곰팡이병을 일으키고, 옥수수에 이삭썩음병과 밑둥썩음병을 발생시키는 F. vorosii를 추가해야 한다(Lee 등, 2016).
이상으로 국내에서는 F. sambucinum 종복합체에서 5종(F. armeniacum, F. asiatiucm, F. vorosii, F. graminearum, F. sambucinum)이 24개의 기주에 식물병을 일으키는 것으로 확인되었다. 콩에 뿌리썩음병을 일으키는 F. armeniacum, 귀리, 밀, 벼, 보리, 옥수수에 붉은곰팡이병을 일으키는 F. asiaticum, 고구마에 밑썩음병, 귀리, 밀, 벼, 보리, 큰조아재비, 호밀풀에 붉은곰팡이병을, 수수에 이삭곰팡이병, 옥수수에 이삭썩음병, 일본잎갈나무와 잣나무에 모잘록병, 참외에 열매썩음병, 카네이션에 모마름병, 콩에 뿌리 및 줄기 썩음병을 일으키는 F. graminearum, 참외에 열매썩음병을 일으키는 F. sambucinum, 벼와 보리에 붉은곰팡이병을, 옥수수에 이삭 및 밑둥 썩음병을 일으키는 F. vorosii을 확인하였다. 그러나 한국식물병명목록에는 보고된 것 중, 2개의 종(F. graminearum, F. sambucinum)과 14개의 기주에 대한 식물병만 등록되었기에, 3개의 종(F. armeniacum, F. asiatiucm, F. vorosii)과 함께 10개의 기주에 대한 식물병을 추가해야한다. 또한, 3종(F. boothii, F. meridionale, F. kyushuense)이 일으키는 식물병 정보가 없기에 추가적인 연구가 필요하다. 본 연구는 한국식물병명목록에 추가로 등록해야 할 정보를 제공 하고, 향후에 수행해야하는 Fusarium 연구에 필요한 종의 정보를 제시한다.

NOTES

Conflicts of Interest

No potential conflict of interest relevant to this article was reported.

Acknowledgments

This study was carried out with the suppot (PJ017286) of National Institute of Agricultural Sciences, Rural Development Administration, Republic of Korea.

REFERENCES

An, T. J., Kim, Y. G., Hur, M., Lee, J. H., Lee, Y. J., Cha, S. W. et al. 2015. Physicochemical treatment for the reduction of Fusarium spp. infested in adlay (Coix lacryma-jobi L.) seeds. Korean J. Medicinal Crop Sci. 23: 460-467.
crossref
Aoki, T. and O'Donnell, K. 1998. Fusarium kyushuense sp. nov. from Japan. Mycoscience 39: 1-6.
crossref
Bahadur, A. 2022. Current status of Fusarium and their management strategies. In: Fusarium: An Overview of the Genus, ed. by S. Mahyar Mirmajlessi, IntechOpen, London, UK.
crossref
Broders, K. D., Lipps, P. E., Paul, P. A. and Dorrance, A. E. 2007. Evaluation of Fusarium graminearum associated with corn and soybean seed and seedling disease in Ohio. Plant Dis. 91: 1155-1160.
crossref pmid
Burgess, L. W., Forbes, G. A., Windels, C., Nelson, P. E., Marasas, W. F. O. and Gott, K. P. 1993. Characterization and Distribution of Fusarium acuminatum subsp. armeniacum subsp. nov. Mycologia 85: 119-124.
crossref
Burgess, L. W. and Summerell, B. A. 2000. Taxonomy of Fusarium: Fusarium armeniacum stat & comb. nov. Mycotaxon 75: 347-348.
crossref
Choi, H. W., Hong, S. K., Lee, Y. K. and Kim, W. G. 2013. Diversity and pathogenicity of Fusarium species associated with grain mold of sorghum. Korean J. Mycol. 41: 142-148.
crossref
Choi, H. W., Kim, S. and Hong, S. K. 2020. Diversity and pathogenic characteristics of Fusarium species isolated from wilted soy-beans in Korea. Korean J. Mycol. 48: 297-312.
Choi, J. H., Nah, J. Y., Jin, H. S., Lim, S. B., Paek, J. S., Lee, M. J. et al. 2019a. Identification and chemotype profiling of Fusarium species in Korean oat. Res. Plant Dis. 25: 157-163. (In Korean).
crossref pdf
Choi, J. H., Nah, J. Y., Jin, H. S., Lim, S. B., Paek, J. S., Lee, M. J. et al. 2019b. Occurrence of Fusarium species in Korean sorghum grains. Res. Plant Dis. 25: 213-219. (In Korean).
crossref pdf
Choi, J. H., Nah, J. Y., Lee, M. J., Jang, J. Y., Lee, T. and Kim, J. 2021. Fusarium diversity and mycotoxin occurrence in proso millet in Korea. LWT 141: 110964.
crossref
Crous, P. W., Lombard, L., Sandoval-Denis, M., Seifert, K. A., Schroers, H. J., Chaverri, P. et al. 2021. Fusarium: more than a node or a foot-shaped basal cell. Stud. Mycol. 98: 100116.
pmid pmc
Gerlach, W. and Nirenberg, H. 1982. The Genus Fusarium: A Pictorial Atlas. Kommissionsverlag P. Parey, Berlin, Germany. pp. 406 pp.
Goswami, R. S. and Kistler, H. C. 2004. Heading for disaster: Fusarium graminearum on cereal crops. Mol. Plant Pathol. 5: 515-525.
crossref pmid
Han, K. S., Park, J. H. and Park, Y. M. 2001. Stub dieback of carnation caused by. Fusarium graminearum. Plant Pathol. J. 17: 101-105.
Hong, S. K., Lee, S., Lee, T., Ham, H., Mun, H. Y., Choi, H. W. et al. 2015. Diversity of mycotoxigenic Fusarium armeniacum isolated from rice grains at harvest time in Korea. Korean J. Mycol. 43: 158-164.
Jang, J. Y., Baek, S. G., Choi, J. H., Kim, S., Kim, J., Kim, D. W. et al. 2019. Characterization of nivalenolproducing Fusarium asiaticum that causes cereal head blight in Korea. Plant Pathol. J. 35: 543-552.
crossref pmid pmc pdf
Jang, Y., Yi, H., Maharjan, R., Jeong, M. and Yoon, Y. 2022. First report of root rot caused by Fusarium armeniacum on soybean in Korea. Plant Dis. 106: 1306.
crossref
Kang, I. J., Shim, H. K., Heu, S. and Kim, K. S. 2020. First report of soybean root and stem rot caused by Fusarium graminearum in South Korea. Plant Dis. 104: 568.
crossref
Kim, D. H., Kim, S. H., Kwon, S. W., Lee, J. K. and Hong, S. B. 2013. Fungal diversity of rice straw for meju fermentation. J. Microbiol. Biotechnol. 23: 1654-1663.
crossref pmid
Kim, D. W., Kim, G. Y., Kim, H. K., Kim, J., Jeon, S. J., Lee, C. W. et al. 2016. Characterization of nivalenolproducing Fusarium culmorum isolates obtained from the air at a rice paddy field in Korea. Plant Pathol. J. 32: 182-189.
crossref pmid pmc
Kim, H. K., Cho, E. J., Lee, S., Lee, Y. S. and Yun, S. H. 2012. Functional analyses of individual mating-type transcripts at MAT loci in Fusarium graminearum and Fusarium asiaticum . FEMS Microbiol. Lett. 337: 89-96.
crossref pmid
Kim, J. W. and Kim, H. J. 2004. Fusarium fruit rot of posthavest oriental melon (Cucumis melo L. var. makuwa Mak.) caused by Fusarium spp. Res. Plant Dis. 10: 260-267. (In Korean).
crossref
Kumar, S., Stecher, G. and Tamura, K. 2016. MEGA7: molecular evolutionary genetics analysis version 7.0 for bigger datasets. Mol. Biol. Evol. 7: 1870-1874.
crossref pmid pmc pdf
Laraba, I., McCormick, S. P., Vaughan, M. M., Geiser, D. M. and O'Donnell, K. 2021. Phylogenetic diversity, trichothecene potential, and pathogenicity within Fusarium sambucinum species complex. PLoS ONE 16: e0245037.
crossref pmid pmc
Lee, J., Chang, I. Y., Kim, H., Yun, S. H., Leslie, J. F. and Lee, Y. W. 2009. Genetic diversity and fitness of Fusarium graminearum populations from rice in Korea. Appl. Environ. Microbiol. 75: 3289-3295.
crossref pmid pmc pdf
Lee, J., Kim, H., Jeon, J. J., Kim, H. S., Zeller, K. A., Carter, L. L. A. et al. 2012. Population structure of and mycotoxin production by Fusarium graminearum from maize in South Korea. Appl. Environ. Microbiol. 78: 2161-2167.
crossref pmid pmc pdf
Lee, T., Oh, D. W., Kim, H. S., Lee, J., Kim, Y. H., Yun, S. H. et al. 2001. Identification of deoxynivalenol- and nivalenolproducing chemotypes of Gibberella zeae by using PCR. Appl. Environ. Microbiol. 67: 2966-2972.
crossref pmid pmc pdf
Lee, T., Paek, J. S., Lee, K. A., Lee, S., Choi, J. H., Ham, H. et al. 2016. Occurrence of toxigenic Fusarium vorosii among small grain cereals in Korea. Plant Pathol. J. 32: 407-413.
crossref pmid pmc
Liu, Y. J., Whelen, S. and Hall, B. D. 1999. Phylogenetic relationships among ascomycetes: evidence from an RNA polymerse II subunit. Mol. Biol. Evol. 16: 1799-1808.
crossref pmid
Nalam, V. J., Alam, S., Keereetaweep, J., Venables, B., Burdan, D., Lee, H. et al. 2015. Facilitation of Fusarium graminearum infection by 9-lipoxygenases in arabidopsis and wheat. Mol. Plant Microbe-Interact. 28: 1142-1152.
crossref pmid
O'Donnell, K., Kistler, H. C., Cigelnik, E. and Ploetz, R. C. 1998. Multiple evolutionary origins of the fungus causing Panama disease of banana: concordant evidence from nuclear and mitochondrial gene genealogies. Proc. Natl. Acad. Sci. U. S. A. 95: 2044-2049.
crossref pmid pmc
O'Donnell, K., Kistler, H. C., Tacke, B. K. and Casper, H. H. 2000. Gene genealogies reveal global phylogeographic structure and re-productive isolation among lineages of Fusarium graminearum, the fungus causing wheat scab. Proc. Natl. Acad. Sci. U. S. A. 97: 7905-7910.
crossref pmid pmc
O'Donnell, K., Sutton, D. A., Rinaldi, M. G., Sarver, B. A. J., Balajee, S. A., Schroers, H. J. et al. 2010. Internet-accessible DNA sequence database for identifying fusaria from human and animal infections. J. Clin. Microbiol. 48: 3708-3718.
crossref pmid pmc pdf
O'Donnell, K., Ward, T. J., Geiser, D. M., Kistler, H. C. and Aoki, T. 2004. Genealogical concordance between the mating type locus and seven other nuclear genes supports formal recognition of nine phylogenetically distinct species within the Fusarium graminearum clade. Fungal Genet. Biol. 41: 600-623.
crossref pmid
O'Donnell, K., Ward, T. J., Robert, V. A. R. G., Crous, P. W., Geiser, D. M. and Kang, S. 2015. DNA sequence-based identification of Fusarium: current status and future directions. Phytoparasitica 43: 583-595.
crossref pdf
O'Donnell, K., Whitaker, B. K., Laraba, I., Proctor, R. H., Brown, D. W., Broders, K. et al. 2022. DNA sequence-based identification of Fusarium: a work in progress. Plant Dis. 106: 1597-1609.
crossref pmid
Ok, H. E., Kim, D. M., Kim, D., Chung, S. H., Chung, M. S., Park, K. H. et al. 2014. Mycobiota and natural occurrence of aflatoxin, deoxynivalenol, nivalenol and zearalenone in rice freshly harvested in South Korea. Food Control 37: 284-291.
crossref
Reeb, V., Lutzoni, F. and Roux, C. 2004. Contribution of RPB2 to multi-locus phylogenetic studies of the euascomycetes (Pezizomycotina, Fungi) with special emphasis on the lichen-forming Acarosporaceae and evolution of polyspory. Mol. Phylogenet. Evol. 32: 1036-1060.
crossref pmid
Ryu, J. G., Lee, S., Lee, S. H., Son, S. W., Nam, Y. J., Kim, M. et al. 2011. Natural occurrence of Fusarium head blight and its mycotoxins in 2010 harvested barley and wheat grains in Korea. Res. Plant. Dis. 17: 272-279. (In Korean).
crossref
Seo, Y. S., Seo, J. A., Sohn, H. B. and Lee, Y. W. 1998. Production of 8-ketotrichothecenes by Fusarium gramineaerum on corn and barley. Korean J. Plant Pathol. 14: 418-424.
Starkey, D. E., Ward, T. J., Aoki, T., Gale, L. R., Kistler, H. C., Geiser, D. M. et al. 2007. Global molecular surveillance reveals novel Fusarium head blight species and trichothecene toxin diversity. Fungal Genet. Biol. 44: 1191-1204.
crossref pmid
Summerell, B. A. 2019. Resolving Fusarium: current status of the genus. Annu. Rev. Phytopathol. 57: 323-339.
crossref pmid


ABOUT
BROWSE ARTICLES
EDITORIAL POLICY
FOR CONTRIBUTORS
Editorial Office
Rm,904 (New Bldg.) The Korean Science & Technology Center 22, Teheran-ro 7-gil, Gangnam-gu, Seoul 06130, Korea
Tel: +82-2-557-9360    Fax: +82-2-557-9361    E-mail: paper@kspp.org                

Copyright © 2026 by The Korean Society of Plant Pathology.

Developed in M2PI

Close layer
prev next