Phylogenetic Analysis of Cucurbit Chlorotic Yellows Virus from Melon in 2020 in Chungbuk, Korea

Taemin Jin; Hae-Ryun Kwak; Hong-Soo Choi; Byeongjin Cha; Jong-Woo Han; Mikyeong Kim

doi:10.5423/RPD.2023.29.1.52

Res. Plant Dis > Volume 29(1); 2023 > Article

2020년 충북지역 멜론에서 발생한 Cucurbit Chlorotic Yellows Virus의 계통분석

Research Article

Research in Plant Disease 2023;29(1):52-59.

Published online: March 31, 2023

DOI: https://doi.org/10.5423/RPD.2023.29.1.52

2020년 충북지역 멜론에서 발생한 Cucurbit Chlorotic Yellows Virus의 계통분석

진태민¹, 곽해련², 최홍수², 차병진¹, 한종우^1,^3,^*, 김미경^1,^*

¹충북대학교 식물의학과

²국립농업과학원 작물보호과

³충청북도 농업기술원

Phylogenetic Analysis of Cucurbit Chlorotic Yellows Virus from Melon in 2020 in Chungbuk, Korea

Taemin Jin¹, Hae-Ryun Kwak², Hong-Soo Choi², Byeongjin Cha¹, Jong-Woo Han^1,^3,^*, Mikyeong Kim^1,^*

¹Department of Plant Medicine, Chungbuk National University, Cheongju 28644, Korea

²Crop Protection Division, National Institute of Agricultural Science, Rural Development Administration, Wanju 55365, Korea

³Chungbuk Agricultural Research and Extension Services, Jincheon 27832, Korea

^*Co-corresponding authors J.-W. Han
Tel: +82-43-220-5831 Fax: +82-43-220-5555 E-mail: cuhan@korea.kr M. Kim
Tel: +82-43-261-2509 Fax: +82-43-261-2552 E-mail: mkim00@cbnu.ac.kr

Received February 21, 2023 Revised March 3, 2023 Accepted March 3, 2023

This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0/) which permits unrestricted non-Commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

요 약

Cucurbit chlorotic virus (박과퇴록황화바이러스, CCYV)는 수박, 오이 등의 박과작물에 영향을 미치는 식물바이러스로 담배가루이에 의해 전반된다. 2018년 충북 오이에서 처음 진단된 이후 경상도 등 다른 지역에서도 보고되고 있다. 2020년 충북 진천, 음성지역의 박과작물 온실의 황화 바이러스병 조사에서 멜론, 수박, 잡초 등 채집시료 총 79시료에 대한 CCYV 특이프라이머를 이용한 reverse transcription-polymerase chain reaction 결과 멜론 4개의 시료에서 CCYV가 확인되었다. 3점은 CCYV 단독감염, 1점는 Cucurbit aphid borne yellows virus 와 Watermelon mosaic virus 복합감염으로 나타났다. 4개의 CCYV ES 분리주로부터 RNA 1, 2의 전체게놈을 얻었고, 이전에 GenBank에 보고된 CCYV 분리주들과 염기서열을 분석하였다. MEGA를 이용하여 계통분석결과 ES 분리주들은 하나의 그룹으로 나타났고, 중국 분리주들과 밀접한 관련이 있었다. ES 분리주들 유전적 다양성이 낮은 것으로 나타났고, 일반적으로 CCYV은 기주 및 지리적 기원에 따라 유전적 다양성이 거의 없었다. CCYV는 박과작물 생산에 심각한 위협이 될 가능성이 있다. 수박, 잡초 등을 포함한 다양한 CCYV 분리주에 대한 병원성, 가루이 전염 등의 특성에 대한 추가적인 연구가 필요하다.

ABSTRACT

Cucurbit chlorotic yellows virus (CCYV) is a plant virus that causes damage to cucurbit crops such as watermelon and cucumber, and is transmitted by an insect vector known as the whitefly. Since CCYV was first detected on cucumber in Chungbuk in 2018, it has been reported in other areas including Gyeongsang in Korea. In 2020, we performed field surveys of yellowing diseases in the greenhouses growing melon and watermelon in Chungbuk (Jincheon and Eumseong). Reverse transcription-polymerase chain reaction analysis of 79 collected samples including melon, watermelon, and weeds resulted in detection of CCYV in 4 samples: Three samples were singly infected with CCYV and one samples was mixed infected with CCYV, Cucurbit aphid borne yellows virus, and Watermelon mosaic virus. The complete genome sequences of the four collected CCYV melon isolates (ES 1-ES 4) were determined and genetically compared with those of previously reported CCYV isolates retrieved from GenBank. Phylogenetic analyses of RNA 1 and 2 sequences revealed that four ES isolates were clustered in one group and closely related to the CCYV isolates from China. The analysis also revealed very low genetic diversity among the CCYV ES isolates. In general, CCYV isolates showed little genetic diversity, regardless of host or geographic origins. CCYV has the potential to pose a serious threat to melon, watermelon, and cucumber production in Korea. Further studies are needed to examine the pathogenicity and transmissibility of CCYV in weeds and other cucurbits including watermelon.

Keywords: Crinivirus, Cucurbit crops, Cucurbit yellow disease, Melon, Whitefly

서 론

박과작물은 전 세계적으로 연간 1억 8,400만 톤 생산되며, 국내 전체 과채류 생산의 약 60%를 차지하여 경제적으로 중요한 작물 중의 하나이다. 세계적으로 35종 이상의 바이러스가 박과작물에 감염하여 문제를 일으키는 것으로 알려졌다(Lecoq와 Desbiez, 2012; Provvidenti, 1996). 그 중 박과 황화병(Cucurbit yellow disease, CYD)은 Cucurbit chlorotic yellows virus (박과퇴록황화바이러스, CCYV), Beet pseudo yellows virus (비트황화바이러스), Cucurbit yellow stunting disorder virus (박과황화발육장애바이러스, CYSDV), Lettuce infectious yellows virus (상추감염성황화바이러스) 등의 Crinivirus속의 바이러스와 밀접한 연관이 있다(Keshavarz 등 2014; Wintermantel 등, 2009, 2017). Crinivirus속의 바이러스는 체관성으로 주로 담배가루이(Bemisia tabaci)에 의해 전염된다. CYD는 지중해, 중동, 아시아 및 아메리카를 포함한 세계 여러 지역에서 발생하며, 이러한 바이러스에 감염된 식물은 엽육조직의 황화, 잎이 잘 부스러지며, 식물의 활성 저하 등 과실의 크기 및 품질 감소로 경제적 손실이 발생한다(Abrahamian 등, 2015; Mansilla-Córdova 등, 2018). 또한 병 발생 초기증상이 마그네슘, 망간 결핍 등 영양 및 생리장애로 오인되기 쉬어 진단의 어려움이 있다(Wisler 와 Duffus, 2001).

국내에서는 6종 이상 바이러스가 박과작물에 발생하여 피해를 주는 것으로 알려져 있고, 멜론에 황화병을 일으키는 원인으로 2015년 Polerovirus속 Cucurbit aphid borne yellows virus (박과진딧물매개황화바이러스, CABYV)가 보고되었다(Kwak 등, 2018; Lee 등, 2015). CCYV는 2018년 충북지역의 오이에서 처음 진단되었고, 이후 경상도지역 멜론에서 보고되었다(Cho 등, 2021; Kwak 등, 2021). 박과작물에 아직까지 CCYV 이외의 Crinivirus속의 다른 바이러스에 대한보고는 없다. CCYV는 Closteroviridae과의 바이러스로 2004년 일본에서 처음 발생하였다. 이후 중국, 대만, 그리스, 이집트, 미국 등 아메리카, 아시아, 유럽, 아프리카 지역까지 전 세계적으로 보고되었고, 박과작물 이외 지황, 서양무아재비 등에서도 확인되었다(Kavalappara 등, 2022; Kune 등, 2021; Okuda 등, 2010). CCYV에 감염되면 주로 잎의 아래쪽부터 위쪽으로 퇴록반점 및 황화 증상을 보이며, 과실의 상품성이 떨어지는 결과를 초래한다(Orfanidou 등, 2017; Wintermantel 등, 2019). CCYV의 게놈은 single-strand RNA로 구성된 RNA 절편을 가지며, 16개의 단백질을 암호화하는 12개의 개방형해독틀(open reading frame, ORF)이 포함 되어있다. RNA1의 ORF1a 및 ORF1b는 바이러스 RNA 합성을 담당하는 복제효소 복합체를 암호화한다. RNA2는 바이러스 이동, 캡시드화, 담배가루이 전염과 관련된 단백질을 암호화하고 있다. 구체적으로 p22와 p24 단백질은 식물 내에서 바이러스 이동에 관여, p5, p20, p26, p6 단백질은 바이러스 입자를 구성하는 구조 단백질이다. p61 단백질은 식물의 면역 체계를 억제하는 데 관여하는 비구조 단백질이다. 외피단백질은 캡시드 단백질로, 바이러스 RNA를 둘러싸 바이러스 입자를 형성한다(Okuda 등, 2010). Biotype B와 Q 타입의 담배가루이에 의해 반영속적으로 전염된다고 알려져 있다(Gyoutoku, 2009; Li 등, 2016).

본 연구에서는 2020년 충북지역의 수박 및 멜론 포장에서 황화 및 퇴록 증상을 보이는 시료를 채집하여 차세대염기서열(next generation sequencing, NGS) 분석을 통해 새로운 Crinivirus 존재 여부를 확인하고, 충북지역의 추가적인 CCYV 발생현황 및 유전학적 특성을 파악하고자 한다.

재료 및 방법

바이러스병 시료채집 및 진단.

2020년 5-9월 동안 충북 진천, 음성 박과작물 재배포장에서 황화 등 바이러스 유사 증상을 보이는 멜론 61점, 수박 5점 및 주변 잡초 13점(칡, 망초, 왕고들빼기, 가시풀, 가시상추, 익모초, 달맞이꽃, 속속이풀, 깨풀) 총 79점의 시료를 채집하였다. 멜론, 수박, 잡초를 각각 한 묶음으로 ribospin plant kit (GeneAll Biotechnology, Seoul, Korea)를 이용하여 Total RNA를 추출하였다. 추출된 total RNA 는 NanoDrop 2000 Spectrometers (Thermo Fisher Scientific, Wilmington, DE, USA)와 TapeStation RNA Screen Tape (Agilent, Santa Clara, CA, USA)를 활용해 품질을 측정하여 선발하였다. 선발된 total RNA는 trupSeq Stranded Total RNA with Ribo-Zero Plant kit (Illumina, San Diego, CA, USA)를 이용해 cDNA로 합성했으며(Macrogen, Seoul, Korea) 최종적으로 transcriptome De novo Sequencing (NovaSeq 6000, Illumina)을 통해 생성된 read들을 assemble해 바이러스 관련 유전체를 분석하였다. 그리고 CCYV를 포함한 NGS에서 확인된 바이러스는 종 특이프라이머를 이용하여 바이러스 감염을 확인하였다(Table 1). Reverse transcription-polymerase chain reaction (RT-PCR)는 SuPrimeScript RT-PCR Premix (2×) (GeNetBio, Daejeon, Korea)을 이용하여 cDNA합성을 위해 50 ^o C에서 30분간 처리 후 95 ^o C에서 10분간 denaturation 진행하였다(Bang 등, 2022). 그리고 95 ^o C에서 30초, 55-65 ^o C에서 30초, 72 ^o C에서 1분으로 35회 반복하였다. 반복 후에 72 ^o C에서 5분간 extension 반응을 진행하였다. RT-PCR 산물의 5 μ l를 1% agarose gel 에 전기영동을 이용하여 증폭 여부를 확인하였다.

Table 1.

Primers used for the detection of cucurbit viruses

Virus	Name	Sequence (5′→3′)	Amplicon size (bp)	Annealing temp (^o C)
CABYV	CABYV-u4	ACACGAGTTGCAAGCATTGGAAGT	457	55
	CABYV-d3806	AGTATTCCAGAGCTGAATGCTGGG
CCYV	CCYV_CP_for	ACGCGCGGCAGAGGAATTTGT	373	65
	CCYV_CP_rev	CCCGGTGCCAACTGAGACACG
CMV	CMV_RNA3_F	TGGTCGTCCAACTATTAACCAC	321	58
	CMV_RNA3_R	TACTGATAAACCAGTACCGGTGA
CmEV	CmEVF	GGTGGAATATGGGTTGATGCTAG	412	58
	CmEVR	CGTCGTGATGGACATCAACTCTAC
WMV	WMV-UNI-1F	CAGTTTGAATCATGGTACAGCGC	392	55
	WMV-UNI-1R	TGTGCTATTGCTTCTCTTGCCC

CABYV, Cucurbit aphid borne yellows virus; CCYV, Cucurbit chlorotic yellows virus; CMV, Cucumber mosaic virus; CmEV, Cucumis melo endornavirus; WMV, Watermelon mosaic virus.

바이러스 전체 게놈 증폭.

CCYV 전체 게놈 증폭을 위하여 NCBI에 등록된 CCYV RNA1, 2 염기서열을 이용하여 RNA1, 2를 각각 3개 절편으로 나누어 2-3 kb 정도로 증폭될 수 있게 프라이머를 디자인하였다(Table 2, Fig. 1). cDNA 와 PCR 증폭은 AMV RT (Promega, Madison, WI, USA), Superscript III RTase (Invitrogen, Carlsbad, CA, USA), Ex Taq DNA polymerase (Takara, Toyo, Japan)를 이용하여 실시하였다. 증폭된 유전자 산물을 주형으로 하여 염기서열 분석용 프라이머를 이용하여 PCR 증폭을 수행하였다(Table 3). 바이러스의 말단 염기서열은 Okuda 등(2010)의 논문을 참고하여 RNA 1 5′/3′ race, RNA2 5′/3′ race 프라이머를 이용하여 5′/3′ RACE Kit, 2nd Generation kit (Roche, Basel, Switzerland)로 수행하였다. 증폭된 PCR 산물은 Expin Combo GP kit (GeneAll Biotechnology)로 정제하여 pGEM-T Easy Vector (Promega)에 클로닝한 후 콜로니 3개를 선발하여 염기서열을 얻었다(Biofact, Daejeon, Korea).

Fig. 1.

Diagram of genome organization of Cucurbit chlorotic yellows virus isolate genome. The open reading frames (ORFs) are indicated by boxes and the noncoding regions are drawn by lines. Double-headed arrows indicate the location of the fragments amplified by polymerase chain reaction with each pair of primers.

Table 2.

Primers used to amplify the complete Cucurbit chlorotic yellows virus genome

Segment	Name	Sequence (5′→3′)	Loci	Length (bp)
RNA1	CCYV_RNA1_1for	GGAAATCAACACTCCTTCGT	1-20	3,103
	CCYV_RNA1_3103rev	CAGATCGAAAATATCATTCAACG	3,081-3,103
	CCYV_RNA1_2739for	CTGAGTATTACACACCATCGC	2,739-2,759	3,312
	CCYV_RNA1_6051rev	GGAGGTTATAAGTGCTAAACG	6,031-6,051
	CCYV_RNA1_5800for	GCATGAGGTACAAGGTGG	5,800-5,817	2,807
	CCYV_RNA1_8607rev	GGCCTAGCTATACTAATAAC	8,588-8,607
RNA2	CCYV_RNA2_1for	GGAAATTATCCACGGTTTCC	1-20	3,038
	CCYV_RNA2_3038rev	CACTTTCCTTCAAACTCACC	3,057-3,038
	CCYV_RNA2_2748for	CGATCTTAAGCATTTACTAACTTACG	2,748-2,773	3,213
	CCYV_RNA2_5961rev	GCATTACTCCATGTTCTACC	5,942-5,961
	CCYV_RNA2_5679for	GGTTGTAGTAAATAATGGAGAGC	5,679-5,701	2,363
	CCYV_RNA2_8041rev	GSCCTAGCTATGCTACTAAC	8,022-8,041
RACE ^a	Oligo(dT)-anchor	GACCACGCGTATCGATGTCGACTTTTTTTTTTTTTTTTV
RACE ^a	PCR- anchor	GACCACGCGTATCGATGTCGAC

^a Rapid amplification of cDNA ends (RACE) primers were supplied from 5′/3′ RACE Kit, 2nd Generation (Roche).

Table 3.

Nucleotide sequence of primers used for sequencing

Segment	Name	Sequence (5′→3′)	Loci
RNA1	1-1 For	GAGACCTGTTGATGTGTTAG	742-761
	1-1 Rev	GTGGACTCGGTGAAATC	1,733-1,749
	1-2 For	CATTACTCAACACAATAACCAC	1,593-1,614
	1-2 Rev	CTCATCTAACCTCAATACTGTG	2,533-2,554
	1-3 For	GGAGTTGATACGCATGAAC	3,473-3,491
	1-3 Rev	CCGAGAATATTGACGTGTC	4,361-4,379
	1-4 For	GTATCTTAGGAGTTACTGTGTC	4,243-4,264
	1-4 Rev	GGCAGTGTGAGTCAAAGC	5,213-5,230
	1-5 For	GAGAATGGTTGGCTTCAAGG	6,493-6,512
	1-5 Rev	CAATATGGTGGCTTTCAGG	7,499-7,517
	1-6 For	CACCAATCAGACGAAGAG	7,309-7,326
	1-6 Rev	CATTTCCAACGTGTTCAATTCG	8,048-8,069
RNA2	2-1 For	CGTTATCAATCCGACAAGTTG	802-822
	2-1 Rev	CGTAAGTACCACCGCCAAG	1,795-1,813
	2-2 For	CAGTACCAGCAGATTATAAGTG	1,637-1,658
	2-2 Rev	CTCTAATATACCATCCACACTA	2,571-2,592
	2-3 For	GTACACAGAAGATGACATTGC	3,449-3,469
	2-3 Rev	CGAATCTCATCCAAGGAAC	4,428-4,446
	2-4 For	CTGTGTTAAGAGGTTTGATCC	4,289-4,309
	2-4 Rev	CTCGTCTGGTGATGGTTC	5,226-5,243
	2-5 For	CCAGAACCAGTTAAACCAG	6,371-6,389
	2-5 Rev	CCTAAAGTTCTATTGTTCTCGG	7,339-7,360
	2-6 For	CGGTATGAGCTTGAATGATG	7,175-7,194

염기서열 및 계통발생학적 유연관계분석.

각 염기서열 및 ORF은 Geneious Prime과 MEGA-X 프로그램을 이용하여 전체 염기서열을 결정하였다. Alignment와 유전학적 계통 분석을 위해서 미국국립생물정보센터(National Center for Biotechnology Information, NCBI)의 GenBank 상의 염기서열이 밝혀진 CCYV 12 분리주에 대한 염기서열 정보를 수집하였다(Table 4). CYSDV의 염기서열(NC_004809, NC_004810)을 outgroup으로 사용하여 유전자와 아미노산 수준에서 계통학적 유연관계를 분석을 하였다. Phylogenetic tree는 MEGA-X 프로그램의 최적모델 찾기를 후 bootstrap 1,000반복으로 neighbor-joining과 maximum likelihood의 방법으로 수행하였다.

Table 4.

Database accession numbers and isolate information for the complete genome sequences used in the phylogenetic analyses

Isolate	Accession no.		Host	Geographical origin	Reference
Isolate	RNA1	RNA2	Host	Geographical origin	Reference
-	AB523788	AB523789	Melon	Japan-Kumamoto	Okuda et al. (2010)
CaF1-523_1	MW629379	MW629380	Melon	USA: Georgia	Kavalappara et al. (2021)
Georgia	OM489400	OM489401	Raphanus raphanistrum	USA	Kavalappara et al. (2022)
TW	KY618798	KY618799	Melon	Taiwan	Unpublished
IL	MH477611	MH477612	Watermelon	Israel	Luria et al. (2019)
GDXW	MZ392422	MZ392423	Cucumber	China	Unpublished
CC-XH	MT048668	MT048669	Zucchini	China: Shandong	Unpublished
SD	MH819190	MH819191	Melon	China: Shandong Shouguang	Unpublished
Rg	MW768903	MW768904	Rehmannia glutinosa	China	Zhang et al. (2021)
Beijing	JQ904628	JQ904629	Cucumis	China: Beijing	Unpublished
DSMZ PV-1020	MZ405663	MZ405664	Cucumis melo	Sudan	Unpublished

결과 및 고찰

박과작물의 황화병을 일으키는 바이러스를 조사하기 위해, 2020년 5-10월 사이 충북의 박과 주요재배인 진천 및 음성지역의 수박과 멜론 시설하우스를 조사하였다. 육안조사 결과 멜론에서는 황화 및 퇴록 증상이 뚜렷하게 관찰된 반면, 수박에서는 일부 포장의 몇몇 개체에서만 모자이크 및 퇴록 증상이 관찰되었다(Fig. 2). 황화 및 퇴록 증상을 보이는 멜론 61점과 모자이크, 퇴록 증상을 보이는 수박 5점의 잎 시료를 채집하였고, 온실 안의 바이러스 의심 증상을 보이는 잡초 13점을 채집하였다. 바이러스 존재를 확인하기 위해 멜론, 수박, 잡초 각각을 묶음으로 3점에 대해 NGS를 수행했으며, 확인된 바이러스는 CCYV, CABYV, Cucumis melo endornavirus (멜론엔도르나바이러스, CmEV), Cucumber mosaic virus (오이모자이크바이러스, CMV) Watermelon mosaic virus (수박모자이크바이러스, WMV)였다. CCYV 이외 Crinivirus속의 다른 바이러스는 확인되지 않았다. NGS에서 확인된 5종 바이러스를 대상으로 RT-PCR 진단 결과 시료 79점 중 멜론 4점에서만 CCYV가 확인되었고, 수박 및 잡초에서는 CCYV가 검정되지 않았다. 황화 증상을 보이는 대부분의 시료에서는 CABYV, CMV 등 다른 바이러스가 진단되었다. 멜론 61점 중 CABYV는 67.2%, CMV 39.3%, WMV 37.7%, CmEV 3.2% 비율로 검정되었다. 수박시료 2점에서 WMV, CABYV가 각각 진단되었다. 깨풀(Acalypha australis) 1점에서 WMV, 익모초(Leonurus japonicus Houtt)에서 CABYV, 칡(Pueraria montana) 2점에서 WMV가 진단되었다(Table 5). CCYV는 충북 음성지역의 멜론 시설하우스 한 곳의 채집 시료 10점 중 4점에서만 확인되었고, 4점 중 3점은 CCYV 단독감염, 1점는 CABYV와 WMV 복합감염으로 나타났다.

Fig. 2.

Symptoms of Cucurbit chlorotic yellows virus, showing yellowing (A) and interveinal yellowing (B) on middle to lower portions of a melon plant.

Table 5.

Viruses detected in cucurbit crops and weeds collected in 2020 in Chungbuk

Host	No. of total samples	No. of samples positive by PCR
Host	No. of total samples	CCYV	CABYV	CmEV	CMV	WMV
Cucumis melo	61	4	41	2	24	23
Citrullus vulgaris	05	0	01	0	00	01
Acalypha australis	02	0	00	0	00	01
Cenchrus echinatus	01	0	00	0	00	00
Conyza canadensis	02	0	00	0	00	00
Lactuca indica	01	0	00	0	00	00
Lactuca serriola	01	0	00	0	00	00
Leonurus japonicus Houtt.	01	0	01	0	00	00
Oenothera biennis	01	0	00	0	00	00
Pueraria montana	03	0	00	0	00	02
Rorippa palustris	01	0	00	0	00	00
Total	79	4	42	2	24	25

PCR, polymerase chain reaction; CCYV, Cucurbit chlorotic yellows virus; CABYV, Cucurbit aphid borne yellows virus; CmEV, Cucumis melo endornavirus; CMV, Cucumber mosaic virus; WMV, Watermelon mosaic virus.

멜론에서 얻은 CCYV 4개 분리주(ES 1-4, CV201126-5~8)로부터 RNA 1은 약 8,606-8,610 nt, RNA 2는 8,041-8,048 nt의 최종 염기서열을 결정하였다(GenBank accession nos. OQ694041-44, OQ709406-09). 4개의 ES 분리주의 게놈 구성과 크기는 유사하였고, 그들 사이에 99.6-99.8% 높은 상동성을 나타냈다. 기존에 NCBI GenBank에 등록된 CCYV 12개 분리주와 염기서열 분석결과, 뉴클레오티드 수준에서 RNA1은 99.6-99.9%, RNA2는 99.5-99.9%로 나타났다. 계통학적 분석 결과 ES 분리주들은 하나의 그룹으로 나타났고, 중국의 오이, 쥬키니, 멜론, 지황 분리주들과 같은 그룹으로 나타났다. 반면에 미국, 일본, 대만, 이스라엘 분리주는 다른 그룹으로 나타났다(Fig. 3). RNA 1, 2 모두 중국 분리주들과 가장 높은 상동성을 보였으나, 나머지 분리주들의 차이가 1% 미만으로 낮았다. 2020년 충북 멜론 분리주들 유전적 다양성은 낮았다. 현재까지 CCYV는 유전적 변이가 크지 않다고 알려져 있고, 기주 및 지리적 거리와 상관없이 유사성이 높았다는 결과가 보고되었다(Orfanidou 등, 2017).

Fig. 3.

Phylogenetic tree based on nucleotide sequences alignments of the RNA 1 (A), RNA 2 (B) of cucurbit chlorotic yellows virus. The analyses were conducted in MEGA X using maximum likelihood method and Tamura-Nei model with 1,000 bootstrap replicates. The percentage of trees in which the associated taxa clustered together is shown next to the branches. Cucurbit yellow stunting disorder virus was used as an outgroup. GenBank accession number used in the phylogenetic tree analysis: AB523788, AB523789 (Japan, melon), MW629379, MW629380 (USA, melon), OM489400, OM489401 (USA, Raphanus raphanistrum), KY618798, KY618799 (Taiwan, melon), MH477611, MH477612 (Israel, watermelon), MZ392422, MZ392423 (China, cucumber), MT048668, MT048669 (China, zucchini), MH819190, MH819191 (China, melon), MW768903, MW768904 (China, Rehmannia glutinosa), JQ904628, JQ904629 (China, cucumis), MZ405663, MZ05664 (Sudan, cucumis).

국내 박과작물 특히 멜론에서의 황화병의 주요 원인은 진딧물이 매개하는 CABYV로 인식되어 왔으나, 2018년 충북지역 오이에서 CCYV 확인됨에 따라 추가적인 조사가 필요하였다. 그리스의 경우도 CCYV가 처음 보고된 이후 매년 박과 작물에서 CCYV가 진단되었다고 한다(Orfanidou 등, 2017). 2020년 충북지역 진천, 음성의 멜론에서의 CCYV 발생은 6% 정도로 높지 않았지만, 국내 토마토에서 발생하는 Crinivirus속 Tomato chlorotic virus (토마토퇴록바이러스) 경우처럼 가루이를 통한 확산의 위험성이 높을 것으로 판단한다(Kwon 등, 2022). Crinivirus 는 Potyvirus, Ipomovirus를 포함한 여러 다른 속의 바이러스와 복합감염되어 병징, 유전적 변이 및 전염효율 등의 상호작용 일으킨다고 보고되었다(Gil-Salas 등, 2011; Wintermantel 등, 2008). 충북지역 멜론 시설하우스에서의 CABYV 및 WMV 등과 복합감염을 확인하였지만, 전국의 CCYV 발생 상황을 유추하기엔 자료가 부족하다. 그리고 여러가지 경로로 증상이 유사한 CYSDV 등 Crinivirus속의 다른 바이러스의 유입의 가능성도 있기 때문에 유전자 진단을 통한 지속적인 바이러스병 발생 모니터링, 전국을 대상으로 유전적 변이분석 및 역학 등의 추가적인 연구가 필요할 것으로 생각된다.

NOTES

Conflicts of Interest

No potential conflict of interest relevant to this article was reported.

Acknowledgments

This research was supported by Chungbuk National University Korea National University Development Project (2020).

REFERENCES

Abrahamian, P., Sobh, H., Seblani, R. and Abou-Jawdah, Y. 2015. Co-infection of two criniviruses and a begomovirus enhances the disease severity in cucumber. Eur. J. Plant Pathol. 142: 521-530.

Bang, Y. H., Song, E. G., Lee, Y. and Ryu, K. H. 2022. Occurrence of viruses and viroids in chrysanthemum plants (Dendranthema morifolium) cultivated in Yesan-gun, Chungcheongnam-do in Korea. Res. Plant Dis. 28: 237-244.

Cho, I. S., Kim, T. B., Yoon, J. Y., Chung, B. N., Hammond, J. and Lim, H. S. 2021. First report of cucurbit chlorotic yellows virus infecting Cucumis melo (muskmelon and oriental melon) in Korea. Plant Dis. 105: 2740.

Gil-Salas, F. M., Peters, J., Boonham, N., Cuadrado, I. M. and Janssen, D. 2011. Yellowing disease in zucchini squash produced by mixed infections of cucurbit yellow stunting disorder virus and cucumber vein yellowing virus. Phytopathology 101: 1365-1372.

Gyoutoku, Y., Okazaki, S., Furuta, A., Etoh, T., Mizobe, M., Kuno, K. et al. 2009. Chlorotic yellows disease of melon caused by cucurbit chlorotic yellows virus, a new Crinivirus. Jpn. J. Phytopathol. 75: 109-111.

Kavalappara, S. R., Milner, H., Sparks, A. N., McGregor, C., Wintermantel, W. M. and Bag, S. 2021. First report of cucurbit chlorotic yellows virus in association with other whitefly-transmitted viruses in yellow squash (Cucurbita pepo) in Georgia, U.S.A. Plant Dis. 105: 1862.

Kavalappara, S. R., Riley, D. G., Cremonez, P. S. G., Perier, J. D. and Bag, S. 2022. Wild radish (Raphanus raphanistrum L.) is a potential reservoir host of cucurbit chlorotic yellows virus. Viruses 14: 593.

Keshavarz, T., Shams-Bakhsh, M., Izadpanah, K. and Malboobi, M. A. 2014. Occurrence and genome analysis of cucurbit chlorotic yellows virus in Iran. J. Phytopathol. 162: 523-526.

Kwak, H.-R., Byun, H.-S., Choi, H.-S., Han, J.-W., Kim, C.-S., Wintermantel, M. W. et al. 2021. First report of cucurbit chlorotic yellows virus infecting cucumber in South Korea. Plant Dis. 105: 1862.

Kwak, H.-R., Lee, H. J., Kim, E.-A., Seo, J.-K., Kim, C.-S., Lee, S. G. et al. 2018. Complete genome sequences and evolutionary analysis of cucurbit aphid-borne yellows virus isolates from melon in Korea. Plant Pathol. J. 34: 532-543.

Kwon, Y., Cha, B. and Kim, M. 2022. Patterns of the occurrence of TYLCV and ToCV with whitefly on summer-cultivated tomato in greenhouse in Gwangju, Gyeonggi Province. Res. Plant Dis. 28: 39-45.

Lecoq, H. and Desbiez, C. 2012. Viruses of cucurbit crops in the Mediterranean region: an ever-changing picture. Adv. Virus Res. 84: 67-126.

Lee, H. J., Kim, M.-K., Lee, S. G., Choi, C. S., Choi, H.-S., Kwak, H. R. et al. 2015. Physiological characteristics of melon plants showing leaf yellowing symptoms caused by CABYV infection. Korean J. Hortic. Sci. Technol. 33: 210-218.

Li, J., Liang, X., Wang, X., Shi, Y., Gu, Q., Kuo, Y.-W. et al. 2016. Direct evidence for the semipersistent transmission of cucurbit chlorotic yellows virus by a whitefly vector. Sci. Rep. 6: 36604.

Luria, N., Smith, E., Sela, N., Koren, A., Lachman, O. and Dombrovsky, A. 2019. Insights into a watermelon virome contribute to monitoring distribution of whitefly-borne viruses. Phytobiomes J. 3: 61-70.

Mansilla-Córdova, P. J., Bampi, D., Rondinel-Mendoza, N. V., Melo, P. C. T., Lourenção, A. L. and Rezende, J. A. M. 2018. Screening tomato genotypes for resistance and tolerance to tomato chlorosis virus. Plant Pathol. 67: 1231-1237.

Okuda, M., Okazaki, S., Yamasaki, S., Okuda, S. and Sugiyama, M. 2010. Host range and complete genome sequence of cucurbit chlorotic yellows virus, a new member of the genus Crinivirus. Phytopathology 100: 560-566.

Orfanidou, C. G., Baltzi, A., Dimou, N. A., Katis, N. I. and Maliogka, V. I. 2017. Cucurbit chlorotic yellows virus: insights into its natural host range, genetic variability, and transmission parameters. Plant Dis. 101: 2053-2058.

Provvidenti, R. 1996. Diseases caused by viruses. In: Compendium of Cucurbit Diseases, eds. by T. A. Zitter, D. L. Hopkins and C. E. Thomas, pp. 37-45. APS Press, St. Paul, MN, USA.

Wintermantel, W. M., Cortez, A. A., Anchieta, A. G., Gulati-Sakhuja, A. and Hladky, L. L. 2008. Co-infection by two criniviruses alters accumulation of each virus in a host-specific manner and influences efficiency of virus transmission. Phytopathology 98: 1340-1345.

Wintermantel, W. M., Gilbertson, R. L., Natwick, E. T. and McCreight, J. D. 2017. Emergence and epidemiology of cucurbit yellow stunting disorder virus in the American Desert Southwest, and development of host plant resistance in melon. Virus Res. 241: 213-219.

Wintermantel, W. M., Hladky, L. L., Cortez, A. A. and Natwick, E. T. 2009. A new expanded host range of cucurbit yellow stunting disorder virus includes three agricultural crops. Plant Dis. 93: 685-690.

Wintermantel, W. M., Hladky, L. L. J., Fashing, P., Ando, K. and McCreight, J. D. 2019. First report of cucurbit chlorotic yellows virus infecting melon in the new world. Plant Dis. 103: 778.

Wisler, G. C. and Duffus, J. E. 2001. Transmission properties of whitefly-borne criniviruses and their impact on virus epidemiology. In: Virus-Insect-Plant Interactions, eds. by K. F. Harris, O. P. Smith and J. E. Duffus, pp. 293-308. Academic Press, San Diego, CA, USA.

Zhang, K., Zhuang, X., Guo, X., Xu, H., He, Z. and Chen, J. 2021. Cucurbit chlorotic yellows virus infecting Rehmannia glutinosa was detected in China. Plant Dis. 105: 3310.