Res. Plant Dis > Volume 26(4); 2020 > Article
A Rapid and Simple Detection Assay for Rice Bacterial Leaf Blight by Recombinase Polymerase Amplification

ABSTRACT

Rice bacterial leaf blight (BLB) by Xanthomonas oryzae pv. oryzae (Xoo) is considered to be one of the major rice diseases steadily occurring around the rice-producing countries. In this study, we developed a recombinase polymerase amplification (RPA) assay for the rapid, convenient and specific diagnosis of Xoo by targeting Xoo-specific transposase A gene. As the target gene can be amplified in 10 min without DNA extraction process and special equipment for temperature control, RPA for BLB can be useful and practical component for on-site diagnosis.

서 론

벼 흰잎마름병은 그람음성 간균 세균 Xanthomonas oryzae pv. oryzae (Xoo)에 의해 발생하는 벼의 주요 병 중 하나로(Mew, 1987), 우리나라를 비롯한 벼 주요 재배지인 일본, 대만, 필리핀, 인도, 인도네시아 등에서 발생하여 피해를 주고 있다(Mew, 1989; Mizukamid와 Wkimoto, 1969). 잎의 상처나 기공, 수공 등으로 침입하여 감염되므로 태풍이나 집중호우 시 발생이 증가하며(Mizukami와 Wkimoto, 1969), 우리나라에는 서남해안 지역과 남해안 지역이 발생 상습지역으로 알려져 있다(Cho, 1978; Lee, 1975; Yun 등, 1985). 감염된 벼는 잎마름 증상이 나타나, 침입 부위부터 하얗게 마르면서 병징이 도관을 따라 진전되며 심한 경우 감수성 품종의 벼가 고사하기도 한다(Choi 등, 1967). 잎의 도관부에 병원균이 증식하여 광합성과 양분의 이동을 저해하므로, 종실의 등숙률이 저하되어 쌀 수량이 감소하고 미질이 저하한다(Ezuka와 Kaku, 2000; Ou 1985; Rao와 Kauffman, 1977; Reddy 등, 1979; Shin 등, 1992).
일반적으로 벼 흰잎마름병 특이 primer를 이용한 PCR법(Shim 등, 2012)으로 벼 흰잎마름병을 검출하거나, real-time PCR법으로 균 검출과 밀도측정을 하였으나(Noh 등, 2013) 이들 방법은 유전자 증폭에 2-3시간이 소요되며 thermal cycler나 real-time PCR 등의 고가장비를 필요로 한다. 등온증폭법 중 하나인 recombinase polymerase amplification (RPA)는 유전자 증폭 소요시간이 5-20분 정도로 신속하고 35-42°C의 비교적 저온의 등온조건에서 반응하므로 특별한 장비 없이 체온을 이용해서도 유전자 증폭을 수행할 수 있다.
본 연구에서는 신속성, 간편성, 특이성을 갖춘 분자진단법 중 하나인 RPA법을 이용하여 벼 흰잎마름병 진단법을 개발하였다.

재료 및 방법

시험재료

본 연구에 사용한 벼흰잎마름병균은 국립식량과학원에서 저항성검정에 사용하는 각 레이스별 대표균주 HB01013 strain (K1 race, KACC21802), HB01014 strain (K2 race, KACC17860), HB01015 strain (K3 race, KACC21803), HB01009 strain (K3a race, KACC16182)의 4종으로 생물작용제인 벼 흰잎 마름병 제조시설로 허가받은 작물기초기반과 병해충실험동에서 초저온냉동고(-80°C)에 glycerol stock으로 보관하며 필요 시 배양하여 병 접종, gDNA 추출 등을 수행하였으며, 진단 특이성 확인에 사용한 세균벼알마름병균(Burkholderia glumae)은 국립식량과학원에서 병 검정에 사용하는 대표균주인 GR6 strain으로 배양하여 gDNA 추출에 사용하였다.

목표유전자 서열비교

기존 벼 흰잎마름병 진단 primer의 목표유전자 중 하나인 transposase A (Shim 등, 2012)의 참고서열과 국립식량과학원 대표균주 4종의 염기서열을 비교하여 transposase A 유전자 서열이 5개 strain 모두에서 동일함을 확인하였으며(Table 1), 종특이성 확인을 위해 Nucleotide Blast (Basic Local Alignment Search Tool) (Altschul 등, 1990)를 수행한 결과 GenBank에 등록된 대부분의 벼흰잎마름병균 간에 높은 상동성을 보이나 일부 strain (MAI73 strain, GenBank sequence ID: CP019086.1 등)의 IS30 family transposase 유전자와는 5′ 앞부분에서만 상동성이 있는 것을 확인하였다(Fig. 1). 또한 Xoo를 제외한 Xanthomonas속 일부에서 유사성이 나타났으나 이들은 벼 병원균이 아니므로 이를 통해 목표유전자 transposase A의 종특이성을 확인하였다(Table 2).

Primer 제작

RPA용 최적 primer를 선발하기 위해 transposase A 유전자 염기서열을 PrimedRPA program (TwistDx, Ltd., Cambridge, UK) (Higgins 등, 2019)에 적용하여 후보 primer 서열들을 얻은 후 transposase A 유전자 앞부분에 결합하는 예상 증폭크기 200 bp의 primer set를 선발하였으며 (Table 3), 기존 진단 primer set (XOT-F/-R) (Shim 등, 2012)보다 종특이성이 높은 염기서열을 증폭 목표로 하는 RPA primer set(BLB_RPA_F/_R)의 transposase A 결합위치는 Fig. 2와 같다. 예상 증폭 영역의 염기서열에 대한 Nucleotide Blast (Altschul 등, 1990) 결과 염기서열 비교에 사용한 5종을 포함한 대부분의 Xoo 유전체에서 3 copy로 존재함을 확인하였다.

Xoo의 gDNA 추출

국립식량과학원 벼 흰잎마름병 대표균주 4종에서 유전자 증폭의 주형으로 사용할 gDNA를 추출하였다. nutrient broth 배지 5 ml에 28°C, 150 rpm 조건으로 16시간 진탕배양한 균을 원심분리하여 수확한 후 Blood & Cell Culture DNA Mini Kit (Qiagen, Hilden, Germany)로 제조사 매뉴얼에 따라 사용하여 gDNA를 추출한 후 BioDrop Duo (Biochrome, Cambridge, UK)로 농도를 측정하였다.

RPA 조성 및 반응

RPA는 TwistAmp Basic Kit (TwistDx Ltd.)로 제조사 매뉴얼에 따라 반응을 수행하였다. 간단히 정리하면, 10 μM primer 각각 2.4 μl, primer free rehydration buffer 29.5 μl, template (gDNA) 3.2 μl, distilled water 10 μl를 혼합하여 총 47.5 μl의 반응액을 만들어 tube 바닥의 reaction pellet과 잘 섞은 후 280 mM magnesium acetate (MgOAc) 2.5 μl를 추가하여 섞은 직후 39°C에서 5분간 반응하였다. 반응온도 유지는 등온 유지 장치에 따른 재현성 확인을 제외하고는 모두 thermal cycler (C1000 touch, Bio-Rad, Hercules, CA, USA)를 사용하였다.

최적 조건 확립

반응온도 및 반응시간의 최적조합을 확립하기 위해여 35-42°C 사이의 온도조건을 C1000 touch의 gradient 기능으로 설정(각 well별로 35.4°C, 36.4°C, 37.7°C, 39.4°C, 40.8°C, 41.6°C, 42°C), 증폭시간은 3-30분 사이(3, 5, 10, 15, 20, 25, 30분)로 설정한 후 최적 등온증폭반응 조건을 탐색하였다. 주형 DNA로는, 목표유전자 염기서열 비교를 통해 transposase A의 염기서열은 레이스별로 동일함을 확인하였기에, K1 레이스 (HB01013)의 gDNA를 10 ng/μl 농도로 사용하였으며 반응이 끝난 후 반응액의 1/10 (5 μl)을 2% agarose gel, 1×TAE에서 1시간 동안 100 V의 조건으로 전기영동하여 산물 증폭 여부를 확인하였다.

특이성 확인

RPA 반응에서 primer의 종특이성 확인을 위해 벼흰잎마름병균 K1 레이스(HB01013), K2 레이스(HB01014), K3 레이스(HB01015), K3a 레이스(HB01009) 4종과 벼 세균병인 세균벼알마름병균의 gDNA(10 ng/μl)를 주형으로 BLB 진단 RPA 반응을 수행하였다. 식량과학원 세균벼알마름병균 대표균주인 GR6 strain에서 Xoo와 동일하게 gDNA를 추출하여 사용하였으며 반응이 끝난 후 전기영동을 통해 산물 증폭 여부를 확인하였다.

감염 잎(병징)을 이용한 Direct RPA

식물체 병징 부위의 DNA 추출 없이 직접 벼 흰잎마름병을 진단하기 위한 RPA 반응조건을 탐색하였다. 감염 잎의 병징 부위와 건전 잎을 각각 멸균한 가위로 1 cm×1 cm 크기로 자른 뒤 1.5 ml 튜브에 멸균 3차 증류수 500 μl와 함께 넣어 plastic pestle로 마쇄한 즙액을 주형으로 사용하였다. 모든 레이스에 감수성을 타나내는 밀양 23호에 벼 흰잎마름병을 접종한 후 나타난 병징을 대상으로, 1 cm2 내에 활력 있는 병원균이 고농도로 존재하도록 잎의 변색 부위와 녹색부위의 경계를 포함하여 시료 채취를 하였으며, 반응이 끝난 후 전기영동을 통해 산물 증폭 여부를 확인하였다.

민감도 비교

RPA와 Taq 중합효소 기반 PCR 사이의 민감도 비교를 위해 K1 레이스(HB01013)에서 추출한 gDNA 농도를 1×10 ng/μl부터 1×10-7 ng/μl (1 fg/μl)까지 10배 단위로 연속희석하여 주형으로 사용하여 반응시킨 후 산물 증폭 여부로 민감도를 비교하였다. Taq 중합효소 기반 PCR 진단에 벼흰잎마름병 병균 검출 키트(RDX-XOO-II, TNT Research, Jeonju, Korea)를 매뉴얼에 따라 사용하였으며, RPA는 39°C 5분 조건으로 반응한 후 전기영동을 통해 산물 증폭 여부를 확인하였다.

등온 유지 장치에 따른 재현성 확인

등온을 유지할 수 있는 다양한 장치에서 동일하게 증폭반응이 일어나는지 확인하기 위해, 다음과 같은 3종의 장비와 손을 이용하여 온도조건을 부여하였다. Thermal cycler (C1000 Touch, Bio-Rad), 항온수조(Isotemp 2301, Thermo Fisher Scientific, Waltham, MA, USA), 발열블록(CHB-202, Bioer, Hangzhou, China) 그리고 체온(30대 여성, 귀 체온 36.7°C [Termoscan IRT 6510, Braun, Kronberg, Germany]) 조건에서 증폭반응 여부를 살피기 위해, 기기에서는 39°C에서 5분간, 체온의 경우 손으로 튜브를 쥔 채 5분간 반응시킨 후 전기영동을 통해 산물 증폭 여부를 확인하였다

결과 및 고찰

RPA의 최적 반응 온도를 확인하기 위하여 온도조건 35-42°C에서 등온증폭을 실시하였다. 그 결과 35-42°C의 모든 온도 별로 증폭 여부 및 증폭량이 균일하게 나타남을 gel 상에서 육안으로 확인하였기에(Fig. 3) 이후의 반응 온도는 39°C를 기본으로 설정하였다.
RPA 최적 반응 시간을 확인하기 위해 3-30분 사이에서 반응시킨 후 전기영동한 결과, 육안관찰 시 5분 이상의 반응조건에서 증폭산물이 뚜렷하게 관찰되었기에(Fig. 4) 이후의 모든 반응시간은 기본을 5분으로 설정하였다.
RPA 반응에서 primer의 특이성을 확인하기 위해 벼흰잎마름 병균의 레이스 4종 K1, K2, K3, K3a와 벼 세균병인 세균벼알마름병균을 대상으로 RPA 진단의 종특이성을 검증한 결과 벼흰잎마름병균의 4종 레이스 K1-K3, K3a에서는 200 bp 크기의 증폭 산물이 생성되었으나 세균벼알마름병균에서는 증폭산물이 생성되지 않아(Fig. 5) 벼 흰잎마름병 진단 특이성이을 검증 하였으며 예상 증폭산물 염기서열의 Nucleotide Blast에 의한 primer의 종특이성 예측과 실제 RPA 반응결과가 동일하게 나타남을 확인하였다.
DNA 추출 없이 감염된 식물체로부터 직접 균 검출이 가능한지 확인하기 위해 벼 흰잎마름병에 감염된 벼 잎, 건전한 잎을 각각 1 cm2 크기로 잘라 멸균수와 함께 마쇄한 즙액으로 증폭 반응을 수행한 결과 감염 잎의 즙액에서는 증폭산물이 형성되었으며, 건전 잎의 즙액에서는 증폭이 일어나지 않았으므로 (Fig. 6) 감염식물체 조직의 DNA 추출 없이 간단히 병징 의심부위 마쇄액을 주형으로 RPA를 수행하여 벼 흰잎마름병 감염 여부 진단이 가능함을 확인하였다.
RPA와 Taq 중합효소 기반 PCR의 민감도를 비교한 결과(Fig. 7), RPA는 주형 gDNA 농도 10 fg/μl (위 7번 lane) 이상에서, Taq 중합효소 기반 PCR 진단 kit에서는 주형 gDNA농도 100 fg/μl (아래 6번 lane) 이상에서 목표유전자 증폭 산물이 gel 상에서 육안으로 뚜렷하게 관찰되어 RPA 진단의 민감도가 기존 진단 kit보다 약 10배 높음을 확인하였다.
RPA법은 농업 현장, 농촌지도현장의 일선에서 고가의 thermal cycler 없이도 등온조건을 유지하여 산물증폭 반응을 수행하여 간단한 전기영동장치만으로 유전자기반 분자진단을 수행할 수 있다는 장점이 있으므로, 다양한 등온조건에서 RPA법에 의한 진단의 재현성을 검토하기 위해 유전자증폭기, 항온수조, 발열블록, 체온을 이용하여 RPA를 수행한 결과 모든 온도부여 조건에서 뚜렷한 증폭산물이 생성됨을 확인하였다(Fig. 8).
본 연구를 통해 개발한 RPA 기반 벼흰잎마름병균 검출법은 벼흰잎마름병균에 대한 종특이성이 뛰어나며, 35-42°C의 넓은 온도조건에서 반응이 안정적이며, 짧은 시간(5분) 안에 증폭반응이 일어나며, DNA 추출 없이 마쇄 즙액으로도 진단이 가능하며, 기존 Taq 중합효소 진단보다 민감도가 높고 primer의 종특이성이 높으므로 기존 진단법보다 신속, 간편, 정확한 진단이 가능하다.

요 약

Xanthomonas oryzae pv. oryzae는 벼 흰잎마름병을 일으키는 세균이며, 벼 흰잎마름병은 벼 주요 재배지에서 꾸준하게 발생하고 있다. 본 연구에서는 벼흰잎마름병균을 신속하고 간편하게 검출하기 위해 등온증폭법 중 하나인 recombinase polymerase amplification (RPA)를 적용하여 현장진단 등을 위한 유전자기반 진단법을 개발하였다. RPA법은 짧은 시간의 등온 조건에서 유전자 증폭이 가능하다는 장점이 있다. 본 연구에서 개발한 벼 흰잎마름병 RPA 진단법은 39°C에서 5분간만 반응하면 목표유전자의 증폭이 이루어지므로 기존 진단법보다 신속하고 간편하며 우리나라에 존재하는 K1-K3a의 4종 레이스에 모두 적용가능하며, DNA 추출 없이 식물체 잎의 즙액으로 증폭반응 수행이 가능하며 기존 Taq 기반 PCR보다 약 10배 검출 민감도가 높고 고가의 thermal cycler 없이도 항온수조, 발열블록 혹은 체온을 이용한 증폭반응 수행이 가능하다. 벼흰잎마름병은 벼의 농작물재해보험 대상재해 병충해 중의 하나이므로 과학적 진단결과가 요구되나, 일선 농촌지도 현장에서는 유전자기반 진단을 위한 장비, 기술 등의 부족으로 분자진단이 어려웠다. 본 연구에서 개발한 벼 흰잎마름병 RPA 진단을 활용한다면 병징 의심부위 마쇄액을 주형으로, 손으로 5분 동안 반응시키는 것만으로도 신속하고 간편하게 벼 흰잎마름병의 목표유전자 증폭산물을 형성하므로 벼 흰잎마름병 진단의 최일선에서 활용할 수 있을 것이다.

Acknowledgments

This research was carried out with support from the Rural Development Administration project (project No. PJ01357302) and we appreciate the support.

NOTES

Conflicts of Interest

No potential conflict of interest relevant to this article was reported.

Fig. 1
Sequence alignment of transposase A and IS30 family transposase by CLUSTALW. Transposase A sequence from Xanthomonas oryzae pv. oryzae (Xoo) KACC 10331 strain (GenBank no. AE013598.1); IS30 family transposase sequence from Xoo MAI73 strain (GenBank no. CP019086.1).
rpd-26-4-195-f1.jpg
Fig. 2
Primer binding site of transposase A gene. Location of transposase A is 46,296-46,826 of Xanthomonas oryzae pv. oryzae KACC 10331 strain (GenBank no. AE013598.1). BLB_RPA_F/_R, RPA primer designed in this study; XOT-F/-R, transposase A primer (Shim et al., 2012).
rpd-26-4-195-f2.jpg
Fig. 3
Optimizing the reaction temperature of recombinase polymerase amplification (RPA) assay. RPA was performed under range of 35°C to 42°C. Lane M, 100 bp DNA ladder marker; lanes 1-8, DNA products ran at 42°C, 41.6°C, 40.8°C, 39.4°C, 37.7°C, 36.4°C, 35.4°C, and 35°C, respectively.
rpd-26-4-195-f3.jpg
Fig. 4
Optimization of the reaction time of the recombinase polymerase amplification (RPA) assay. RPA was performed under range of 3 to 30 min. Lane M, 100 bp DNA ladder marker; lane 1-7, DNA products ran for 3, 5, 10, 15, 20, 25, and 30 min, respectively; lane8, negative control.
rpd-26-4-195-f4.jpg
Fig. 5
Testing the specificity of the recombinase polymerase amplification assay using four Xanthomonas oryzae pv. oryzae Korean race and Burkholderia glumae. Lane M, 100 bp DNA ladder marker; lane 1, K1 race (HB01013); lane 2, K2 race (HB01014); lane 3, K3 race (HB01015); lane 4, K3a race (HB01009); lane 5, Burkholderia glumae GR6; lane 6, negative control.
rpd-26-4-195-f5.jpg
Fig. 6
Recombinase polymerase amplification detection of bacterial leaf blight in rice leaves. Lane M, 100 bp DNA ladder marker; lane 1, crude sap of BLB infected leaf; lane 2, crude sap of healthy leaf; lane 3, positive control; lane 4, negative control.
rpd-26-4-195-f6.jpg
Fig. 7
Assessments of the analytical sensitivity of the recombinase polymerase amplification (RPA) and PCR assay. Lane M, 100 bp DNA ladder marker; lanes 1-8, RPA (top) and PCR (bottom) products from reactions containing 10 ng/μl, 1 ng/μl, 100 pg/μl, 10 pg/μl, 1 pg/μl, 100 fg/μl, 10 fg/μl, and 1 fg/μl of the DNA, respectively; lane 9, negative control.
rpd-26-4-195-f7.jpg
Fig. 8
Comparison of recombinase polymerase amplification reaction on various thermostatic equipments. Lane M, 100 bp DNA ladder marker; lanes 1 and 2, positive and negative control in thermocycler; lanes 3 and 4, positive and negative control in heating block; lanes 5 and 6, positive and negative control in water bath; lanes 7 and 8, positive and negative control in body temperature (hand).
rpd-26-4-195-f8.jpg
Table 1
Identities of transposase A gene in Xoo used in this study
Strain Race location of transposase A GenBank no. Identities to KACC 10331 (%)
HB01013 K1 3,225,263-3,224,733 CP049205.1 100
HB01014 K2 2,331,688-2,331,158 CP050113.1 100
HB01015 K3 2,634,260-2,633,730 CP050114.1 100
HB01009 K3a 1,842,705-1,843,235 CP050115.1 100

Xoo, Xanthomonas oryzae pv. oryzae.

Table 2
Nucleotide Blast result of transposase A gene excluding Xoo
Species Gene Gen Bank no. Cover (%) Identities (%) Host
X. vasicola strain NCPPB 902 Oligopeptidase A CP034657.1 99 91.48 (15 bp deletion) -
X. v. pv. vasculorum strain Xv1601 Oligopeptidase A CP025272.1 99 91.29 (17 bp deletion) Corn
X. v. pv. vasculorum strain SAM119 Oligopeptidase A CP028127.1 99 91.29 (17 bp deletion) Corn
X. v. pv. arecae strain NCPPB 2649 Oligopeptidase A CP034653.1 100 90.96 (17 bp deletion) Areca nut
X. campestris pv. musacearum NCPPB 4379 Oligopeptidase A CP034655.1 99 91.29 (15 bp deletion) Banana

Xoo, Xanthomonas oryzae pv. oryzae.

Table 3
RPA primer set for Xoo detection
Primer name Sequence (5’-3’) Size (bp) Tm (℃) GC (%) Size (bp)
BLB_RPA_F CTTGATTCCTGGGCACTGGGAAGGCGACCTGA 32 73 59.4 200
BLB_RPA_R GGTCATAGGTGAGGCTTCCCAGCAGGCAATGC 32 72 59.4

RPA, recombinase polymerase amplification; Xoo, Xanthomonas oryzae pv. oryzae.

References

Altschul, S. F., Gish, W., Miller, W., Myers, E. W., Lipman, D. J. 1990. Basic local alignment search tool. J. Mol. Biol. 215: 403-410.
crossref pmid
Cho, Y. S. 1978 Problems and prospect of bacterial leaf blight of rice in Korea. Seoul Natl. Univ. Coll. Agric. Bull. 3: 65-74. (In Korean).
Choi, Y. C., Lee, S. K., Chung, B. J., Lee, K. H., Cho, Y. S. 1967 Studies on the varietal trials of rice to the bacterial leaf blight [Xanthomonas oryzae (Uyeda et Ishiyama) Dowson] in Korea. Res. Rep. Off. Rural Dev. 20: 93-100. (In Korean).
Ezuka, A., Kaku, H. 2000. A historical review of bacterial blight of rice. Bull. Natl. Inst. Agrobiol. Resour. (Jpn.). 15: 1-207.
Higgins, M., Ravenhall, M., Ward, D., Phelan, J., Ibrahim, A., Forrest, M. S., et al 2019. PrimedRPA: primer design for recombinase polymerase amplification assays. Bioinformatics. 35: 682-684.
crossref pmid
Lee, K.-H. 1975 Studies on the epidemiology and control of bacterial leaf blight of rice in Korea. Korean J. Appl. Entomol. 14: 111-131. (In Korean).
Mew, T. W. 1987. Current status and future prospects of research on bacterial blight of rice. Ann. Rev. Phytopathol. 25: 359-382.
crossref
Mew, T. W. 1989. An overview of the world bacterial blight situation. Bacterial Blight of Rice. International Rice Research Institute; Manila, Philippines: p. 7-12.
Mizukami, T., Wakimoto, S. 1969. Epidemiology and control of bacterial leaf blight of rice. Ann. Rev. Phytopathol. 7: 51-72.
crossref
Noh, T.-H., Kang, M.-H., Seo, S.-J., Shim, H.-K., Choi, M.-Y., Park, J.-C., et al 2013 Measurement of density for Xanthomoanas oryzae pv. oryzae cell using real time PCR. Korean J. Int. Agric. 25: 194-199. (In Korean).
crossref
Ou, S. H. 1985. Rice Diseases. 2nd ed. Commonwealth Mycological Institute; Ferry Lane, UK: p. 381.
Rao, P. S., Kauffman, H. E. 1977. Portential yield losses in dwarf rice varieties due to bacterial blight in india. J. Phytopathol. 90: 281-284.
crossref
Reddy, A. P. K., MacKenzie, D. R., Rouse, D. I., Rao, A. V. 1979. Relationship of bacterial leaf blight severity to grain yield of rice. Phytopathology. 69: 967-969.
crossref
Shim, H.-K., Noh, T.-H., Kang, M.-H., Park, Y.-J., Lee, D.-K., Lee, B. M., et al 2012. Rapid identification and validation of Xanthomonas oryzae pv. oryzae (Xoo) by using PCR-amplified Phage integrase and transposase a gene. Korean J. Int. Agric. 24: 219-225.
Shin, M. S., Shin, H. T. J, un, B. T., Choi, B. S. 1992 Effects of inoculation of compatible and incompatible bacterial blight races on grain yield and quality of two rice cultivars. Korean J. Breed. Sci. 24: 264-267. (In Korean).
Yun, M.-S., Lee, E.-J., Cho, Y.-S. 1985 Pathogenic specialization of the rice bacterial leaf blight pathogen, Xanthomonas campestris pv. oryzae: race classification based on reactions of Korean differential varieties. Korean J. Appl. Entomol. 24: 97-101. (In Korean).
TOOLS
METRICS Graph View
  • 0 Crossref
  •  0 Scopus
  • 478 View
  • 33 Download
Related articles


ABOUT
BROWSE ARTICLES
EDITORIAL POLICY
FOR CONTRIBUTORS
Editorial Office
Rm,904 (New Bldg.) The Korean Science & Technology Center 22, Teheran-ro 7-gil, Gangnam-gu, Seoul 06130, Korea
Tel: +82-2-557-9360    Fax: +82-2-557-9361    E-mail: paper@kspp.org                

Copyright © 2021 by The Korean Society of Plant Pathology.

Developed in M2PI

Close layer
prev next