Res. Plant Dis > Volume 26(3); 2020 > Article
저온과 바이러스 감염에 노출된 사과나무의 생리적 유전자 정량 측정용 유전자들의 발현 분석 및 검증

ABSTRACT

Quantitative reverse transcription PCR is used for gene expression analysis as the accurate and sensitive method. To analyze quantification of gene expression changes in apple plants, 10 housekeeping genes (ACT, CKL, EF-1α, GAPDH, MDH, PDI, THFs, UBC, UBC10, and WD40) were evaluated for their stability of expression during infection by Apple stem grooving virus (ASGV) or in cold-stress apple plant buds. Five reference-gene validation programs were used to establish the order of the most stable genes for ASGV as CKL>THFs>GAPDH>ACT, and the least stable genes WD40<UBC10<EF-1α for infection by ASGV. For treatment by three different temperatures, the most stable genes were WD40>CKL>UBC10, and the least stable genes were ACT<UBC<THFs. To validate our findings, using two of the most stable and the one least stable validated reference genes, one defense responsive gene and one cold-stress-responsive gene were examined to compare their relative changes in gene expression. In conclusion, our results provide a useful framework for choice of suitable reference genes according to different biotic or abiotic stress conditions in plant species.

서 론

식물 바이러스에 의한 기주의 감염은 바이러스의 복제 및 이동을 용이하게 하거나 기주의 다양한 방어 기작에 대항하기 위한 주요한 반응으로 기주 유전자 발현을 교란시킨다(Pallas와 García, 2011; Whitham 등 2006). 최근에 마이크로어레이(microarray) 및 차세대염기서열분석법(next-generation sequencing, NGS) 등 대량 분석법을 이용하여, 고온, 추위 등 비생물학적 원인 및 바이러스가 감염된 식물체에서 유전자 발현 프로파일의 변화를 나타내는 유전자들의 그룹 또는 개별적인 특정하게 표적 유전자에 대하여 활발하게 연구되고 있다(Adams 등 2015; Ishihara 등, 2015; Pecman 등, 2017; Postnikova와 Nemchinov, 2012; Wu 등, 2015). 또한 유전자의 발현은 매우 복잡한 네트워크 형태로 상호 영향을 미치기 때문에 유전자 네트워크를 실시간 또는 정량적인 측정 방법이 필요하다(Postnikova와 Nemchinov, 2012; Tang 등 2019). 대부분의 경우, 이는 식물체 mRNA로부터 역전사(reverse transcription, RT)에 생성된 상보적 DNA (complementary DNA, cDNA)에 대한 실시간 또는 정량적 중합 효소 연쇄 반응(quantitative PCR, qPCR)을 사용하여 수행된다. 정량적역전사중합효소연쇄반응(quantitative reverse transcription PCR, RT-qPCR) 방법은 일반적으로 표준화된 안정한 참조유전자(reference genes)에 대한 표적 유전자발현의 상대적 변화를 측정하기 때문에 식물체 유전자에 영향을 미치는 외부환경요인 등에 대하여 기준 유전자는 먼저 평균값으로 표준화되어야 하며, 특정 기준 유전자 발현의 안정성을 검증하는 것이 중요하다. 이러한 많은 식물 종(species)에서의 유전자 발현의 기준으로서 선발된 소위 대부분 식물종들의세포에서 항상 일정한 수준으로 발현되는 것으로 간주되는 상시 발현 유전자들(house-keeping genes)이라고 불리는 유전자들이 선택되어 정량적 분석법에 사용되어왔다(Chao와 Jost, 2012; Cheng 등, 2013; Wieczorek 등, 2013).
그러나, 바이러스에 감염된 식물체들에 대한 연구들뿐만 아니라 비생물적 스트레스를 받은 식물체들에 대한 유전자 발현 연구들은 상시 발현 유전자 실제로는 안정화된 발현이 이루어지는 것이 아닌 매우 상대적으로 변화에 민감하게 반응한다는 것으로 밝혀졌다(Reddy 등, 2013; Rocha 등, 2015; Wang 등 2014; Webb 2013). 또한 상시 발현유전자들은 식물의 조직 부위 또는 발달과정에서 변화가 있는 경우에도 매우 유전자 발현양이 차이가 있음이 보고되었다(Cheng 등 2013; Mascia 등 2010). 이러한 사실들은 상시 발현 유전자들을 유전자 발현을 위한 기준 유전자들로 사용하기 위해서는 유전자 발현의 유전자의 안정성을 분석하고 검증하는 것이 필요하다. 이를 위해 몇몇 프로그램들이 기준 유전자 발현의 유전자의 안정성을 분석하고 안정성에 대한 참조유전자로서의 적합성을 결정하기 위해 컴퓨터 프로그램이 개발되었다. 유전자의 발현 안정성 값을 계산하기 위해 고려되는 다른 유전자의 안정성과 비교하여 유전자의 평균변이를 결정하는 geNorm (Vandesompele 등, 2002)과 분석된 유전자 사이의 발현 변화를 추정하고 정규화 인자를 계산하기 위해 그룹 내 및 그룹 간의 변화를 고려하는 알고리즘을 가지는 NormFinder (Andersen 등, 2004)가 많이 이용되고 있다. 또한 고려중인 모든 유전자 조합의 쌍별 상호 상관 관계를 분석함으로써 Ct값 데이터 간의 변동을 계산하는 Best-Keeper (Pfaffl 등, 2004)와 비교값인 ΔCt (Silver 등, 2006)는 각 샘플 내에서 유전자 쌍의 상대적인 발현을 비교하는 것으로 알려져 있다(Chao와 Jost, 2012; Cheng 등, 2013; Wieczorek 등, 2013).
사과(Malus domestica)는 국내 및 국외에서 널리 재배되고 있으며 경제적으로 중요한 과일 작물 중 하나이다. 전 세계적으로 7,500개 이상의 종이 알려져 있으며 접목을 통하여 증식하는 식물이다. 사과는 배우체형 자가불화합성 작물이기 때문에 20% 이상의 수분수의 혼식이 필요하며(Broothaerts 등, 2004), 유전체는 이형접합체 형태이며 17개 염색체로 구성된 750 Mb의 유전체 크기를 가지고 있어 활발하게 연구되고 있는 작물이다(Daccord 등, 2017; Velasco 등, 2010). 사과는 주로 접목에 의해 증식하는 영양체 번식 작물이며 대부분 노지 재배가 일반적이므로 노지 포장에서 월동을 하게 되며 이상기온에 따라 꽃눈 등 저온 피해가 빈번히 발생하고 있다. 저온 피해는 사과 세포들의 세포막 구조를 파괴하며, 영양분의 흡수, 분해, 이용 등의 교란을 일으키게 되며, 사과나무의 뿌리, 잎, 꽃, 과실에 광범위하게 나타나게 되어 피해를 일으킨다(Gapper 등, 2017).
또한 사과는 바이러스 또는 바이로이드에 감염되면 광합성양은 감소하며 호흡량 등의 증가로 에너지를 소비하게 되며, 감염된 사과는 저항성 기작이 무력화되므로 각종 다른 병해나 비우호적 환경에 대한 내성이 약해지게 되어 결국 과실이 작아지거나 모양이 변형되는 등 피해를 입게 되어 대략 20-40% 정도 생산량이 감소된다(Cho 등, 2016; Kinard 등, 1996; Lee 등, 2017; Menzel 등, 2002; Wood, 1979). 우리나라에서 사과에 문제가 되는 바이러스는 10여종이 알려져 있으나, 최근의 사과나무 접수와 M9 대목의 바이러스 감염률을 조사한 결과, 사과 퇴록반점 바이러스(Apple chlorotic leaf spot virus, ACLSV), 사과 잎검은점 바이러스(Apple stem grooving virus, ASGV) 감염률이100%이었다(Lee 등, 2017). 이 중 ASGV는 Betaflexiviridae와의 Capillovirus속에 분류되는 바이러스이다. ASGV 유전체는6,500개 내외의 염기로 구성된 단일쇄상의 RNA 게놈을 가지고있으며, 외막이 없는 바이러스 입자는 600-700 nm 크기를 가지고 있다(Ohira 등, 1995).
사과에 대한 연구는 주로 가용성 당 및 유기산과 같은 주요 대사 산물의 생리적 변화, 재배법 연구, 신품종 사과 육종 연구와 이와 관련된 품종 개발을 위한 유전자 발현 프로파일 등에 중점적으로 연구가 수행되어 왔다(Jaakola, 2013; Ma 등, 2019; Takos 등, 2006). 최근 몇 년 전부터 NGS를 이용한 전사체와 생명정보학 기술의 발달에 따라 많은 바이러스들의 감염 과정에 관여하는 유전자들이 동정이 되었으며, 사과나무의 저항성 반응 또는 감염과정에 필수적인 유전자들이 전사체 연구들을 통하여 다량으로 발굴되었으며 유전자 기능에 대하여 연구되고 있다. 또한 저온 등의 비생물학적 스트레스에 반응하는 사과를 포함한 기주 식물들의 반응은 상호 중복되어 일치하는 결과들이 알려지게 되었다(An 등, 2020). 위의 대량 전사체 연구와 생물정보학 이용 분석과정은 신뢰할 수 있는 참조유전자의 식별은 필수 전제 조건이며 후속 발현 분석 연구에 도움을 줄 수 있다. 지금까지 사과에서 참조유전자의 안정성을 평가하기 위한연구는 다른 식물에서 이전에 공개된 기존의 유전자로 제한되었다. 선택된 참조유전자의 발현은 다른 실험 조건에 따라 크게변하는 것으로 입증되었다. 그러므로, 새로운 사과나무의 참조유전자를 식별하고 광범위한 실험 조건에 걸쳐 그들의 발현 안정성을 평가할 필요가 있다.
이번 연구의 목적은 사과에서 신뢰할 수 있는 RT-qPCR 표준화를 위해 안정적으로 발현하는 참조유전자를 선택하는 것이다. 이를 선발하기 위하여 ASGV 감염 또는 건전 사과에서의 안정성에 대해 평가되고 순위가 매겨진 10개의 참조유전자들의 상대적 발현양을 통하여 유전발현 안정성을 평가하였다. 또한 비생물적 스트레스 요인 중 하나인 저온 처리된(5°C, -8°C 및 -15°C) 사과 꽃봉오리에서 이들 참조유전자들의 발현 수준의차이를 비교하여 저온 처리 시 안정한 참조유전자로서 이용 가능성을 조사하였다.

재료 및 방법

시료채취, RNA 추출과 역전사중합효소연쇄반응법(reverse transcription polymerase chain reaction, RT-PCR)

농촌진흥청 국립원예특작과학원에서 보관 및 유지하고 있는 ASGV 단독 감염과 전신 감염된 사과 후지품종과 바이러스 무병 사과 후지품종(이하 무병식물)을 공시재료로 사용하였다(Supplementary Fig. 1). ASGV 감염 또는 무병식물체당 2개 잎에서 4개 부위를 1.5 microcentrifuge tube 뚜껑을 이용하여 채취한 후 액체질소를 이용하여 막자사발에서 마쇄하였다. 이후 제조사의 추천 방법대로 RNeasy Mini Kit (Qiagen, Hilden, Germany)를 이용하여 전체 RNA를 추출하였다. 추출된 RNA 순도는 NanoDrop 분광광도계(Thermo Fisher Scientific, Waltham, MA, USA)를 이용하여 흡광도 260 nm와 280 nm 비율(A260/A280)로 결정하였으며 RNA 농도는 단일쇄상 RNA 보정값을 곱하여 결정하였다. 추출된 전체 RNA는 소량으로 분주하여 -80°C에 보관하였으며 이후 실험에 1회용으로 사용하였다.
ASGV 진단을 위하여 ASGV 특이적 프라이머를 이용하여 RT-PCR로 유전자 진단하였다. RT 반응은, 제조회사의 실험방법에 따라 Superscript III First-Strand Synthesis System (Invitrogen, Carlsbad, CA, USA)를 이용하여 1종 프라이머(ASGV-Rev; 5'-GGAATTTCACACGACTCCTAACCCTCC-3')로 50°C에서 50분(1회) 동안 반응을 시켰다. 제조회사의 실험방법에 따라, RT 반응액을 5 µl를 넣고 Platinum Hot-Start PCR System을 이용하여 ASGV-Rev와 1종 프라이머(ASGV-For; 5'-AAGGGAACTTCTGACGGTTCCTCCC-3')로 PCR를 수행하였다. PCR 조건은 95°C에서 2분 (1회), 95°C 15초, 55°C 30초, 72°C, 50초(35회 반복), 72°C에서 5분(1회)이다. 전기영동은 0.5× TBE buffer와 1.0% agarose gel에서 실시하였고, 분자량 마커로 100 bp DNA ladder를 이용하였다. PCR 증폭 산물(650 bp)은 100 볼트에서 60분 동안 전기영동 후 UV transilluminator를 이용하여 결과를 확인하였다.
바이러스 무병식물을 5°C, -8°C, -15°C 생육상에서 30일간 처리한 후 각각 처리구의 꽃봉오리 4개씩을 무작위로 채취하였다. 저온 처리된 전체 RNA는 위에서 기술된 동일한 방법을 이용하여 추출하였다. 이후 RNA 순도와 농도도 동일한 NanoDrop 분광광도계를 이용하였으며, 추출 RNA는 -80°C 냉동고에 분주하여 보관하여 실험에 사용하였다.

프라이머 제작 및 RT-qPCR

사과의 10개 후보 참조유전자들에 대한 프라이머 세트는 미국국립생물정보센터(National Center for Biotechnology Information, NCBI)의 염기서열 정보를 다운로드 받아 DNAMAN 소프트웨어(버전 5.2.2, Lynnon, Quebec, Canada)를 이용하여 제작하였다(Table 1). RT-qPCR 분석을 위하여, 추출 RNA는 DNase I으로 처리 후 RNeasy MinElute CleanUp Kit (Qiagen)를 이용하여 정제하였다. 첫 번째 cDNA는 1 µg 정제 RNA를 넣은 Superscript III First-Strand Synthesis System (Invitrogen)를 이용하여 random hexamer 프라이머(50 ng/µl)를 포함한 20 µl 반응액으로 50°C에서 50분(1회) 동안 제조회사의 방법에 따라 반응을 시켰다. cDNA는 멸균 3차증류수 첨가하여 1/4로 희석하였다. qPCR은 96-well plate에 희석된 첫번째 cDNA (12.5 ng/µl) 2 µl와 사과 후보 참조유전자들의 특이적 프라이머 세트(5 pmol/µl)를 포함된 25 µl 반응액을 QuantiFast SYBR Green PCR kit (Qiagen)를 이용하여 제조하였다. 반응조건은 95°C 5분(1회), 95°C 10초, 60°C 30초(40회)이며 CFX96 Touch Real-Time PCR System (Bio-Rad, Hercules, CA, USA)을 이용하여 반응을 시켰다. 정량값과 Ct값은 디폴트값으로 제공된 CFX Manage 소프트웨어(버전 1.6, Bio-Rad)를 이용하여 자동으로 계산하였다. Melting curve 분석은 65°C부터 95°C까지 1회당 0.5°C씩 증가시켜서 곡선과 최대 흡광도 증가값(maximum peak of melting curve)의 그래프를 분석하여 반응의 특이성을 검정하였다. 각각 시료들은 최소 3회 반복하여 측정하였으며, 3번 이상의 독립적인 실험에 의해서 유의한 경우에만 데이터를 통계분석에 사용하였다,

Ct 데이터와 통계분석

각각 실험에서 도출된 Ct 데이터는 마이크로소프트 엑셀 소프트웨어로 옮겨 데이터 표를 만든 후 geNorm, NormFinder, BestKeeper, Comparative ΔCt 소프트웨어를 이용하여 후보 참조유전자들의 안정성을 평가하였다(Andersen 등, 2004; Pfaffl 등, 2004; Silver 등, 2006; Vandesompele 등, 2002). qPCR 분석에서 도출된 Ct값은 또한 웹사이트에서 제공하는 RefFinder 소프트웨어를 사용하여 포괄적 분석(http://150.216.56.64/referencegene.php)을 수행하여 후보 참조유전자들의 안정성을 평가하였다. 저온 처리와 ASGV 감염 사과나무에서의 유전자들의 발현의 Ct값들을 이용하여 분산분석법(ANOVA)으로 분석하였으며, 이후 Duncan 다중검정(Duncan’s multiple range test)을 이용하여 분석하였다. 제시된 모든 그래프는 평균과 표준편차 값으로 제시되었으며 P>0.05는 유의성이 없으며 P<0.01은 유의하며, P<0.001은 매우 유의한 것으로 판정하였다.

목표 유전자의 상대적 정량값 분석

사과유전자 전사인자로 알려진 유전자(MDP0000501598, MDP0000585239)를 목표유전자로 선정하였다(Chen 등, 2014). ASGV 감염에 대한 geNorm 분석에 의해 가장 안정적인 발현을 하는 사과의 참조유전자(CKL [casein kinase-1-like protein 2] 유전자 와 ACT [actin-related protein 7] 유전자)와 1개의 가장 불안정적인 참조유전자(WD40 [transcription factor WD40-like repeat protein] 유전자)를 사용하였다. 또한 저온 처리된 사과에 대한 geNorm 분석에 의해 가장 안정적인 발현을 하는 사과의 참조유전자(CKL 및 WD40 유전자)와 1개의 가장 불안정적인 참조유전자(ACT 유전자)를 사용하였다. 정규화 계수는 각 샘플에 대한 CKL, ACT 및 WD40의 기하 평균으로 계산되었으며, ASGV 감염 사과와 무병식물의 조합 및 3개의 서로 다른 저온으로 처리된 사과를 조합으로 하여 실험에 사용하였다. 정량은 PCR 효율 보정과 함께 ΔΔC(t) 알고리즘을 사용하는 Bio-Rad CFX Manager 소프트웨어(버전 1.6)를 사용하여 수행되었으며 RT-qPCR 반응의 마지막에 결과가 자동으로 생성되었다.

결 과

AGSV 감염 사과 및 저온 처리된 사과에 대한 참조유전자 분석

ASGV가 감염된 사과 식물에서 10개의 후보 참조유전자의 발현 안정성을 RT-qPCR을 통해 먼저 조사하였다. 먼저 ASGV 감염된 식물에서 각각의 유전자에 대한 ΔCt를 결정함으로써 3번의 독립적인 실험에 대한 각 후보 참조유전자의 발현의 변화를 분석하였다(Fig. 1). ASGV 감염 사과와 무병식물에서 ΔCt값이 가장 큰 변화를 보이는 유전자는 WD40이었으며, 나머지 9개 유전자들은 ASGV 감염 식물과 무병식물에서 큰 변화가없는 ΔCt값의 변화가 나타났다(Fig. 1A, B). 적은 유전자 발현 정도의 차이는 독립적인 실험에 의한 유전자 발현에 대한 오차가 적은 것을 의미하며 데이터의 유효한 유의성을 말해준다.
3가지 조건으로 저온 처리된 사과나무의 꽃봉오리 시료에서 위에서 기술한 동일한 10개 후보 참조유전자의 발현 안정성을 RT-qPCR 동일한 방법으로 조사하였다. 5°C로 처리된 사과나무의 꽃봉오리에서 ΔCt값이 가장 큰 변화를 보이는 유전자는 GAPDH (glyceraldehyde-3-phosphate dehydrogenase)와 UBC10 (ubiquitin-conjugating enzyme E2 10)이었으며 -8°C 또는 -15°C로 처리된 사과나무의 경우, 가장 큰 ΔCt값의 변화가공통적으로 ACT와 UBC10 유전자 발현에서 나타났다(Fig. 1C-E).
다음으로 실험에서 얻은 ΔCt 데이터를 사용하여 유전자 안정성 분석 프로그램인 geNorm, NormFinder, BestKeeper, Comparative ΔCt 및 RefFinder를 사용하여 개별 바이러스에 감염된 식물에서 가장 안정적인 후보 유전자를 확인하였다.

geNorm을 이용한 유전자 발현 안정성 분석

geNorm (Vandesompele 등, 2002) 프로그램은 각각의 서로 다른 유전자들을 1쌍으로 하여 상호 비교하여 변이를 검사하고 두 개 이상의 후보 참조유전자와 관련된 유전자의 발현 안정성 값을 계산하는(변이율 1.5값보다 적은 경우만 유효) 것으로 알려져 있다.
ASGV 감염 사과식물과 무병식물의 3가지 실험 데이터의 평균에 대한 각 후보 참조유전자에 대한 변이값을 기준으로 한 geNorm 순위는 공통적으로 ACT=CKL>GAPDH>THFs (formate-tetrahydrofolate ligase) 순으로 안정하였으며 MDH (malate dehydrogenase-like)>UBC10>WD40 순으로 유전자 발현이 가장 불안정한 것으로 나타났다(Fig. 2A, B).
5°로 처리된 사과나무의 꽃봉오리 경우, ACT=CKL>GADPH>THFs 순으로 유전자의 발현이 가장 안정적으로 나타났으며 WD40>UBC10>MDH>UBC (ubiquitin-conjugating enzyme E2 22-like)>PDI (protein disulfide isomerase-like-1-6) 순으로 유전자 발현이 가장 불안정한 것으로 나타났다(Fig. 2C).
-8°로 처리된 사과나무의 꽃봉오리 경우, CKL=WD40>MDH>UBC>THFs 순으로 유전자의 발현이 가장 안정적으로 나타났으며 ACT>UBC10>EF-1α (elongation factor 1-alpha)>GADPH>PDI 순으로 유전자 발현이 가장 불안정하였다(Fig. 2D). -15°로 처리된 사과나무의 꽃봉오리 경우, GAPDH=UBC10>MDH>CKL>WD40 순으로 유전자의 발현이 가장 안정적으로 나타났으며 ACTI>THFs>PDI>UBC 순으로 유전자 발현이 가장 불안정하였다(Fig. 2E)

NormFinder를 이용한 유전자 발현 안정성 분석

Norm-Finder (Andersen 등, 2004)는 표준화 값을 계산하기 위해 그룹 내 및 그룹간 변동을 고려하여 후보 유전자 사이의 발현 변동을 추정함으로써 각 후보 참조유전자에 안정성 값을 할당하는 다른 알고리즘을 사용하는 것으로 알려져 있다. 유전자 순위는 함께 조절되는 선택된 유전자의 영향을 받지 않는다.
무병식물 경우, 3번의 독립적인 실험에서 평균화된 4개의 가장 안정한 유전자는 THFs>GAPDH>MDH>UBC10이었으나 ASGV 감염식물의 경우 가장 안정한 유전자는 THFs>CKL>GAPDH>MDH로 무병식물과는 평균 안정성 범위(0.009 vs. 0.011)의 작은 차이를 반영하여 차이가 있었다(Fig. 3A, B). ASGV 감염식물과 무병식물의 경우, geNorm을 사용하여 결정된 것과 동일하게 WD40 유전자의 발현이 가장 불안정한 것으로 조사되었다(Fig. 3A, B).
5°C로 처리된 사과나무의 꽃봉오리 경우, WD40>CKL>MDH 순으로 유전자 발현이 가장 안정적이었으며, ACT>UBC>THFs 순으로 유전자 발현이 불안정하였다(Fig. 3C). -8°C로 처리된 사과나무의 꽃봉오리 경우, CKL>WD40>MDH 순으로 유전자 발현이 안정적이었으며 PDI>UBC10>ACT 순으로 유전자 발현이불안정한 것으로 조사되었다(Fig. 3D). -15°C로 처리된 사과나무의 꽃봉오리 경우, CKL>MDH>UBC 순으로 유전자 발현이안정적이었으며 EF-1α>THFs>ACT 순으로 유전자 발현이 불안정한 것으로 나타났다(Fig. 3E).

BestKeeper를 이용한 유전자 발현 안정성 분석

BestKeeper (Pfaffl 등, 2004)는 후보 참조유전자의 모든 조합의 유전자 상호 상관 관계를 분석하여 Ct 데이터 간의 변동을 계산하는 것으로 알려져 있다. 유효한 기준으로는 Ct값의 표준편차(Table 2의 SD [±Ct])는 <1이며, 절대 조정계수의 SD인 SD [±x-fold]는 식의 허용 가능한 참조유전자의 변화에 대해 <2이어야 한다. 이러한 기준에 근거하여, 9개의 후보 참조유전자(PDI>UBC>EF-1α>MDH>ACT>THF>CKL>GAPDH>UBC10)를 무병식물에서 6개의 후보 참조유전자(CKL>GAPDH>UBC>MDH>ACT>THFs)를 ASGV감염 사과 식물에서 목표유전자 발현의 변화를 검사하는 데 사용할 수 있다(Table 1, Supplementary Table 1). 이에 비해 3개 다른 온도로 저온 처리된 사과나무 꽃봉오리 시료들에서는 순위에 차이는 있지만 10개의 모든 후보 참조유전자들이 유효성이 있게 목표유전자 발현의 변화를 검사하는 데 사용할 수 있는 것으로 나타났다(Table 2).

Comparative ΔCt를 이용한 유전자 발현 안정성 분석

RT-qPCR에서 산출되는 ΔCt값의 비교법(Silver 등, 2006)은 각 시료 내의 모든 후보 참조유전자 쌍의 상대적인 발현을 서로 비교하고 ΔCt의 최소 차이 측면에서 가장 낮은 것에서 가장 높은 것까지 순위를 매긴다. ASGV 감염식물과 무병식물에서 3번의 독립적인 실험의 평균 ΔCt값 데이터에 대하여 가장 적은 변이까지의 순위, 즉 ASGV 감염식물과 무병식물에서 공통적으로 GAPDH>THFs>CKL 순으로 유전자 발현이 가장 안정적인 것으로 분석되었다(Fig. 4A, B). 또한 geNorm과 NormFinder을 사용하여 결정된 것과 동일하게 WD40 유전자의 발현이 가장 불안정한 것으로 분석되었다(Fig. 4A, B).
5°C로 처리된 사과나무의 꽃봉오리 경우, WD40>CKL>GAPDH 순으로 유전자 발현이 가장 안정적이었으며 THFs 유전자 발현이가장 불안정하였다(Fig. 4C). -8°C로 처리된 사과나무의 꽃봉오리 경우, CKL>WD40>UBC 순으로 안정적이었으며 ACT 유전자 발현이 가장 변이가 큰 것으로 분석되었다(Fig. 4D). -15°C로 처리된 사과나무의 꽃봉오리 경우, CKL>MDH>UBC 순으로 ΔCt 비교수치가 적어 유전자 발현이 안정적인 것으로 분석되었으며 -8°C와 동일하게 ACT 유전자 발현이 가장 불안정하였다(Fig. 4E).

ASGV 감염 및 저온 처리된 사과에 대한 참조유전자 순위 비교

앞서 서술한 바와 같이 위에서 사용한 소프트웨어는 서로 다른 알고리즘을 기반으로 하기 때문에 후보 참조유전자 중 안정성 순위가 소프트웨어 사이에 변동이 나타나는 것은 흔하다(Liu 등, 2012; Zhang 등, 2013). 이런 상이성을 보완하기 위하여 위의 소프트웨어와 관련된 알고리즘의 기하학적 수단을 결정하는 방법이 고안이 되었다. 이 중 RefFinder 프로그램은 geNorm, NormFinder, BestKeeper 및 comparative ΔCt의 데이터를 통합하여 전체 권장 종합 순위를 제공함으로써 기하평균값을 결정하여 순위를 결정해준다. 이를 이용하여 ASGV 감염된 사과식물체의 경우, CKL>THFs>GAPDH>ACT 순으로 가장 안정적인 기준 참조유전자로 분석되었다(Table 2). 이들 4개 유전자들의 발현 안정성은 무병식물에서 순위는 다르지만 모두 포함되어 있어 ASGV 감염 사과식물체에서 유전자 발현을 분석하는 기준 참조유전자로 활용이 가능함을 예시해준다(Table 2). ASGV 감염 사과식물과 무병식물에서 공통으로 WD40>UBC10>EF-1α 순으로 불안정한 것으로 조사되었다.
5°C로 처리된 사과나무의 꽃봉오리 경우, WD40>CKL>UBC10 순으로 안정하였으며 -8°C로 처리된 사과나무의 꽃봉오리 경우 CKL>WD40>UBC 순이었으며 -15°C로 처리된 사과나무의 꽃봉오리 경우 CKL>MDH>UBC10 순서로 안정적인 순위를 나타내었다(Table 2). AGSV 감염사과와 무병식물에서 분석된 것과 유사하게 저온 처리된 사과 꽃봉오리에서의 CKL 유전자의 발현은 안정적인 것으로 조사가 되어 ASGV와 저온 처리시 공통적으로 사용할 수 있는 참조유전자로 선발되었다. 흥미롭게도 ASGV 감염 사과식물과 무병식물에서 공통으로 가장 불안정한 발현을 하는 것으로 판정된 WD40 유전자는 저온처리(5°C와 8°C로 처리)된 사과 꽃봉오리에서 안정적인 발현을 하는 참조유전자로 분석이 되었다. 이와 비슷하게 ASGV 감염 사과식물과 무병식물에서 공통으로 안정적 발현을 하는 것으로 4순위로 판정된 ACT 유전자는 -8°C 또는 -15°C로 처리된 사과나무 꽃봉오리 경우에 가장 불안정한 유전자로 순위가 매겨졌다(Table 2). 5°C로 처리된 사과나무 꽃봉오리 경우에도 ACT 유전자는 비교적 불안정한 발현을 하는 것으로 분석되어 위의 사실 분석과 일치하는 경향을 보였다.

ASGV 감염 및 저온 처리된 사과에 대한 목표 유전자 발현의 변화

AGSV 감염 사과식물에서 안정적으로 발현되는 것으로 분석된 CKL과 ACT를 참조유전자로 선발하였으며 가장 불안정한 발현을 보이는 WD40 유전자를 참조유전자의 실험 대조구로 선발하였다. 위 3가지 참조유전자를 사용하여 사과 전사인자로 알려진 유전자(MDP0000501598, MDP0000585239)를 2개의 목표유전자의 발현 수준의 상대 비교를 조사하였다. 한편, 저온 처리된 사과 꽃봉오리 경우, CKL과 WD40는 가장 안정적 발현을 보였으며 ACT가 가장 불안정한 발현을 보인 참조유전자로 분석되었다. 동일하게 3가지 참조유전자를 사용하여 MDP0000501598의 유전자의 상대적 발현양을 조사하였다.
ASGV 감염 사과식물의 경우, 모든 참조유전자들의 상대비교에서 MDP0000501598 (C3HL domain class transcription factor)와 MDP0000585239 (NBS-LRR type disease resistance protein)의 유전자 발현은 무병식물에 비교하여 4배에서 50배 이상 발현이 증가한 경향을 보였다(Fig. 5). CKL과 ACT를 참조유전자로 사용한 경우 MDP0000501598 유전자의 상대 발현양이 MDP0000585239 유전자의 발현양이 증가가 더 컸다. WD40을 참조유전자로 사용한 경우는 반대로 MDP0000585239 유전자의 발현양이 MDP0000501598 유전자의 상대 발현양보다증가되는 경향을 보였다.
-8°C와 -15°C로 처리된 사과 꽃봉오리의 경우, 모든 참조유전자들의 상대비교에서 처리된 MDP0000501598의 유전자 발현은 5°C로 처리된 사과 꽃봉오리에 비해 3배 이상 7배 이하로 발현이 증가한 경향을 보였다(Fig. 5). CKL과 WD40을 참조유전자로 사용한 경우 -15°C로 처리된 사과 꽃봉오리에서 MDP0000501598의 유전자 발현이 -8°C로 처리된 사과 꽃봉오리의 해당 유전자 발현보다 더 높은 경향을 보였으나, 가장 불안정한 ACT를 사용한 경우 이와 반대의 경향을 보였다(Fig. 5). 따라서, 전체적으로, 특정한 검증된 참조유전자에 대해 정규화된 상대적인 발현 수준에서 차이가 관찰되었으나 ASGV 감염사과의 경우 CKL과 ACT, -8°C와 -15°C 처리된 사과 꽃봉오리의 경우 CKL과 WD40의 검증된 참조유전자를 사용함으로써 목표유전자 사이의 상대적인 발현 경향에서 차이는 보이지 않았다. 발현이 불안정한 것으로 판정된 유전자들을 참조유전자로 사용한 경우, 위의 안정 발현을 하는 참조유전자들을 이용한 상대 발현분석과 정반대의 유전자 발현 경향을 나타내었다.

고 찰

식물바이러스의 경우, 유전자 발현에 대한 대부분 연구에서 잎 재료를 조사했으며, 이는 RT-qPCR에 의한 표적 유전자 발현의 변화를 정량화하는 데 사용될 수 있는 안정한 기준 유전자를 확인하는 대부분의 연구에서도 잎 재료를 사용하고 있다. ASGV에 감염된 사과나무는 대부분의 경우 무병징을 나타내는 것으로 알려져 있으며, RNA sequencing 기술을 이용한 대량 유전자 발현 분석으로 AGSV 감염 사과나무에서 발현이 증가되는 184개의 유전자들과 발현이 감소되는 136개 유전자들이 분석되었다(Chen 등, 2014). 발현이 변화되는 유전자들은 세포 주기, 세포벽 합성, 과실 발달, 광합성 관련, 호르몬 합성과 신호전달, 전사 및 발현 조절, 생물학적 또는 비생물학적 스트레스 등 모든 생물학적 기능과 관련된 것으로 조사되었다(Shinozaki와 Yamaguchi-Shinozaki, 2000; Shinozaki 등, 2003; Wan 등, 2017). 이 연구에서는 Actin2 유전자 1개를 참조유전자로 사용하여 다르게 발현되는 유전자들에 대한 검증을 하여 분석하였다. 본 연구에서는 CKL 유전자와 ACT 유전자(Actin7 유전자) 모두 참조유전자로 활용할 수 있음을 보여주었으나 CKL 유전자가ACT 유전자보다는 더 안정적인 참조유전자로 순위가 매겨졌다. Gadiou와 Kundu (2012)가 수행한 연구에서는 사과 잎 샘플에서 ASGV 및 apple mosaic virus의 정확한 발현 정량을 위해 참조유전자로서 GAPDH 및 ribosome을 구성하는 단백질 중 하나인 S19이 선발되었으며 RT-qPCR을 사용하여 두 바이러스의 검출 한계를 검정할 수 있음을 보고하였다. 이들이 사용한 GAPDH도 본 연구에서는 안정적인 참조유전자로 분류되었으나, CKL과 ACT 유전자에 이어 3순위로 조사되었다(Table 3). 다른 연구들에서는 다수의 바이러스 감염이 단일 기주에서 가장 안정적인 참조유전자에 대해 조사되었다(Baek 등, 2017; Lilly 등, 2011; Liu 등, 2012; Mascia 등, 2010; Reddy 등, 2013; Wieczorek 등 2013). 이들 연구의 결과는 다른 기주에서 가장 안정적인 참조유전자가 동일한 바이러스에 대해서도 동일하게 유효하지 않았으며, 동일한 기주에서 다른 바이러스가 때때로 가장 안정적인 참조유전자의 다른 발현 패턴을 나타냈다. 참조유전자의 순위에서 이런 차이는 일부 순위가 작은 변동을 가져왔지만, 경우에 따라서 상당히 큰 차이를 나타내었다. 따라서, 참조유전자에 대해 표준화된 바이러스 감염의 결과로서 mRNA 수준의 변화를 정확하게 정량화하기 위해, 특정 바이러스에 의한 각 식물 종의 감염에 따라 일련의 참조유전자를 실험마다 조건마다 검증할 필요가 있다는 것을 암시한다.
저온 스트레스는 식물의 성장과 발달에 영향을 미치며 농업 생산에서 저온 스트레스는 농작물 동결 피해와 넓은 면적의 수확량 감소를 야기할 수 있으며 심각한 상황에서 농작물 생산
이극히 낮아지는 결과로 이어질 수도 있다(Thakur 등, 2010).또한 사과 생산은 저온 스트레스의 영향을 받기에 저온스트레스 연구를 수행할 필요가 있으며 많은 유전자들이 저온 스트레스에서 발현이 증가하거나 감소되는 것으로 연구되었으며, 유전자 발현 네트워크가 복잡하게 연결이 되어 있음이 보고되었다(An 등, 2018, 2020). 게다가 과실의 부위별, 발달단계에 대한목표유전자의 발현분석을 한 다른 연구에서는 WD40, ACT 및GAPDH는 사과 껍질의 가장 신뢰할 수 있는 참조유전자로 확인되었으며, 사과 과육에 대한 EF-1α, CKL 및 WD40 및 MDH는두 샘플 모두에 대해 가장 안정적인 참조유전자로 보고하였다(Zhu 등, 2019). 이번 연구에서는 저온 처리된 사과 꽃봉오리 이용한 저온 스트레스에는 AGSV 감염 사과 잎에서의 참조유전자선발과는 다르게 WD40과 CKL 유전자 조합을 사용하는 것이RT-qPCR 발현 표준화에 대해 정확한 것으로 분석되었다(Fig. 5). 이런 결과는 2개의 목표 유전자를 사용한 분석 결과에서 잘예시되어 있다. 즉 결과는 단일 발현 안정적인 참조유전자 또는이의 조합이 표준화 목적으로 사용될 때, 발현 수준이 거의 유사함을 보였다. 반대로, 저온 스트레스에서 가장 불안정한 참조유전자(ACT)의 사용은 목표유전자의 발현 프로파일의 해석을 잘못할 수 있는 결과를 생성하게 된다. Bustin 등(2009)은 하나 이상의 기준 유전자를 사용하는 것이 다른 시료와 조건에서 발현 표준화를 위한 유효한 방법이라고 제안했다. 유사하게, 참조유전자에 저온 스트레스의 결과로서 mRNA 수준의 변화를 정확하게 정량화하기 위해, 특정한 저온에 노출, 처리 조건 또는 시험되는 식물 종에 따라, 여러 개의 참조유전자를 검증할 필요가있다는 것을 제시해준다.

요 약

정량적역전사중합효소연쇄반응(quantitative reverse transcription PCR)은 정확하고 민감한 방법으로 유전자 발현 분석에 사용된다. 사과 식물에서 유전자 발현 변화의 정량적 변화를 분석하기 위해, 사과 잎검은점 바이러스(Apple stem grooving virus, ASGV)에 의한 감염 동안 발현의 안정성에 대해 10개 참조유전자들(ACT, CKL, EF-1α, GAPDH, MDH, PDI, THF, UBC, UBC10 및 WD40)을 평가하였다. AGSV 감염 또는 저온 처리된 사과 식물에서의 10개 참조유전자 발현의 안정은 5가지 프로그램을 사용하여 분석하였다. ASGV 감염 사과식물의 잎 조직에서는 CKL>THFs>GAPDH>ACT 순서로 가장 안정한 유전자로 분석되었으며 WD40<UBC10<EF-1α의 순서로 대해 가장 안정하지 않은 유전자로 판정이 되었다. 3가지 다른 저온 처리된 사과 꽃봉오리의 경우, 가장 안정한 유전자는 WD40>CKL>UBC10이고 가장 안정하지 않은 유전자는 ACT<UBC<THFs 순위로 분석되었다. 이런 사실을 검증하기 위해, 가장 안정한 참조유전자들 중 2개 유전자들과 가장 불안정 유전자로 판정된 유전자들 중 1개 참조유전자를 사용하여 분석하였다. 이를 이용하여 1개 방어관련 유전자와 1개 저온스트레스 관련 유전자를 목표유전자로 선정하여 유전자 발현에서의 그들의 상대적 변화를 비교하기 위해 선발하여 검증하였다. 결론적으로, 본 연구의 결과는 식물 종의 상이한 생물적 또는 비생물적 스트레스 조건에 따라 적합한 참조유전자의 선택을 위한 유용한 정보를 제공한다.

Electronic Supplementary Material

Supplementary materials are available at Research in Plant Disease website (http://www.online-rpd.org/).

Acknowledgments

This work was supported by a grant of Basic Research from the National Institute of Horticultural and Herbal Science, Rural Development Administration, South Korea.

NOTES

Conflicts of Interest

No potential conflict of interest relevant to this article was reported.

Fig. 1
Range of Ct cycle threshold values for 10 apple candidate reference genes during infection by apple stem grooving virus (ASGV) or during incubation of three different cold conditions. The box plots show the cycle thresholds with median Ct value (central horizontal line in each box), the 25th and 75th percentile (boxes), and the ranges (whiskers) of the average of three independent experiments. The data were obtained from virus-free apple leaf (A), ASGV-infected apple leaf (B), apple bud incubated at 5°C (C), apple bud incubated at -8°C (D), or apple bud incubated at -15°C (E).
RPD-26-144-f1.jpg
Fig. 2
Expression stability of the 10 candidate reference genes analyzed using geNorm. The average expression stability values (M) are shown for the 10 candidate reference genes, ranking from least stable (left) to most stable (right), using data from the combination of three independent experiments for apple samples. The data show the pairwise variation (V) when the number of reference genes is increased from Vn/n+1 (V2/3, etc.), with a stability maximum of 0.15 permissible, for apple samples. The data were obtained from virus-free apple leaf (A), apple stem grooving virus (ASGV)-infected apple leaf (B), apple bud incubated at 5°C (C), apple bud incubated at -8°C (D), or apple bud incubated at -15°C (E). Data from the combination of three independent experiments, with the mean and standard error bars.
RPD-26-144-f2.jpg
Fig. 3
Expression stability of the 10 candidate reference genes analyzed using NormFinder. The average expression stability values are shown for the 10 candidate reference genes, ranking from least stable (left) to most stable (right), using data from the combination of three independent experiments for apple samples. The data were obtained from virus-free apple leaf (A), apple stem grooving virus (ASGV)-infected apple leaf (B), apple bud incubated at 5°C (C), apple bud incubated at -8°C (D), or apple bud incubated at -15°C (E). Data from the combination of three independent experiments, with the mean and standard error bars.
RPD-26-144-f3.jpg
Fig. 4
Expression and validation of eight candidate reference genes analyzed using delta Ct. (A) Range of Ct cycle threshold values for ten apple candidate reference genes. The box plots showing variation in ΔCt are as described in Fig. 1. The average expression stability values are shown, ranking from least stable (left) to most stable (right), using data from the combination of three independent experiment. The data were obtained from virus-free apple leaf (A), apple stem grooving virus (ASGV)-infected apple leaf (B), apple bud incubated at 5°C (C), apple bud incubated at -8°C (D), or apple bud incubated at -15°C (E). Data from the combination of three independent experiments, with the mean and standard error bars.
RPD-26-144-f4.jpg
Fig. 5
Relative expression levels of two target genes (MDP0000501598, MDP0000585239) during virus infection or cold stress using three normalized reference genes. The relative gene expression levels of the target genes from apple leaf samples (virus-free and apple stem grooving virus [ASGV]-infected) normalized to either two highly stable validated reference genes (CKL, ACT), or one less stable validated reference gene (WD40). The relative gene expression levels of the target genes from apple bud samples incubated at 5°C, -8°C, or 15°C, normalized to either two highly stable validated reference genes (WD40, CKL), or one less stable validated reference gene (ACT). The normalized gene expression in scale bar was presented as 1.0. Data was analyzed using two-way ANOVA and Duncan’s multiple range test (P<0.05). Error bars indicate standard error of mean of three biological replicates.
RPD-26-144-f5.jpg
Table 1
Candidate apple reference genes, primer sequences and amplicon characteristics evaluated by RT-qPCR
Acronym Gene description Accession no.a Primer sequences (5'→3') Amplicon size (bp)
ACT Actin-related protein 7 XR_003774642 For: CCAGTTGTGCGAGGTCTTAT 102
Rev: CTGCCCTTCATTTCCCATTTC
CKL Casein kinase 1-like protein 2 XM_008393131 For: ACGTGACTCAATGCAGATAGAC 99
Rev: AACCCGAACAAGGAGGATTAC
EF-1α Elongation factor 1-alpha XM_008387060 For: CAAGAGTGTGGAGAAGAAGGAG 92
Rev: GGGCGGGACGATAACATAAA
GAPDH Glyceraldehyde-3-phosphate dehydrogenase XM_008341945 For: CGGTGCTGACTTTGTTGTTG 106
Rev: GCTGGGAGCAGAGATGATAAC
MDH Malate dehydrogenase-like XM_008344149 For: GCTCATACGATGTACCTTCTGG 105
Rev: CTTCCTCGAGAACTCGTCAATAG
PDI Protein disulfide isomeraselike 1-6 XM_008344461 For: GTTCCCTACTCTGCTTCTGTTT 88
Rev: CCTCGCCCATGTCACTATTT
THFs Formate-tetrahydrofolate ligase XM_008391920 For: TCATCTCAGTCCCGATCACTAT 115
Rev: CCCTCCAACCACCACATAATAC
UBC Ubiquitin-conjugating enzyme E2 22-like XM_008389247 For: GCTGGCACTCCTTATGAGAAT 96
Rev: CTTCGTCAGGAAGTAGCCTTTAG
UBC10 Ubiquitin-conjugating enzyme E2 10 XM_029106195 For: GTGTTGCTTTCCATCTGTTCTC 113
Rev: CTCGCTGTCGTCTCGTATTT
WD40 Transcription factor WD40-like repeat protein GU173813 For: GTGAGTAGCGTGTCTTCTCTTC 112
Rev: TGTCAAACACGAGGGCATAA

RT-qPCR, quantitative reverse transcription PCR.

aAccession numbers of predicted transcripts in “Malus x domestica genome” of NCBI GenBank used to support for primer design.

Table 2
BestKeeper analysis of data for three independent experiments combined for three viruses
Ranking

1 2 3 4 5 6 7 8 9 10
Virus-free Gene name PDI UBC EF-1α MDH ACT THFs CKL GAPDH UBC10 WD40
SD [±Ct] 0.20 0.20 0.22 0.24 0.24 0.24 0.26 0.27 0.37 1.99
SD [±x-fold] 1.15 1.15 1.16 1.18 1.18 1.18 1.20 1.20 1.29 3.98
ASGV-infected Gene name CKL GAPDH UBC MDH ACT THFs WD40 EF-1α PDI UBC10
SD [±Ct] 0.05 0.16 0.37 0.68 0.70 0.77 0.95 1.89 5.88 7.33
SD [±x-fold] 1.04 1.12 1.29 1.6 1.62 1.70 1.93 3.7 59.08 161.04
Bud/-5°C Gene name PDI CKL UBC MDH THFs WD40 EF-1α UBC10 GAPDH ACT
SD [±Ct] 0.07 0.11 0.14 0.16 0.16 0.17 0.19 0.28 0.29 0.29
SD [±x-fold] 1.05 1.08 1.10 1.12 1.12 1.12 1.14 1.22 1.22 1.22
Bud/-8°C Gene name THFs PDI UBC EF-1α WD40 CKL GAPDH MDH UBC10 ACT
SD [±Ct] 0.10 0.12 0.12 0.13 0.15 0.16 0.18 0.19 0.33 0.37
SD [±x-fold] 1.07 1.09 1.09 1.1 1.11 1.11 1.13 1.14 1.26 1.30
Bud/-15°C Gene name WD40 THFs EF-1α CKL PDI UBC GAPDH MDH UBC10 ACT
SD [±Ct] 0.10 0.12 0.13 0.15 0.16 0.17 0.20 0.21 0.21 0.30
SD [±x-fold] 1.07 1.09 1.10 1.11 1.11 1.13 1.15 1.16 1.16 1.23

ASGV, apple stem grooving virus.

Table 3
RefFinder analysis for ASGV and cold stress
Method Ranking order (most stable genes → least stable genes)

1 2 3 4 5 6 7 8 9 10
Virus-free
Delta Ct GAPDH THFs CKL MDH UBC PDI ACT EF-1α UBC10 WD40
BestKeeper PDI UBC EF-1α MDH ACT THFs CKL GAPDH UBC10 WD40
NormFinder THFs GAPDH MDH UBC10 CKL UBC ACT PDI EF-1α WD40
geNorm ACT CKL GAPDH THFs EF-1α PDI UBC MDH UBC10 WD40
Recommended comprehensive ranking GAPDH THFs CKL ACT PDI MDH UBC EF-1α UBC10 WD40
ASGV-infected
Delta Ct GAPDH THFs CKL UBC MDH ACT PDI EF-1α UBC10 WD40
BestKeeper CKL GAPDH UBC MDH ACT THFs WD40 EF-1α PDI UBC10
NormFinder THFs CKL GAPDH MDH ACT UBC PDI EF-1α UBC10 WD40
geNorm ACT CKL GAPDH THFs EF-1α PDI UBC MDH UBC10 WD40
Recommended comprehensive ranking CKL THFs GAPDH ACT PDI UBC MDH EF-1α UBC10 WD40
Bud/5°
Delta Ct WD40 CKL GAPDH UBC10 EF-1α MDH ACT PDI UBC THFs
BestKeeper PDI CKL UBC MDH THFs WD40 EF-1α UBC10 GAPDH ACT
NormFinder WD40 CKL MDH EF-1α UBC10 GAPDH PDI ACT UBC THFs
geNorm GAPDH UBC10 ACT WD40 EF-1α MDH CKL PDI UBC THFs
Recommended comprehensive ranking WD40 CKL UBC10 GAPDH MDH PDI EF-1α ACT UBC THFs
Bud/-8°
Delta Ct CKL WD40 UBC MDH GAPDH THFs PDI EF-1α UBC10 ACT
BestKeeper THFs PDI UBC EF-1α WD40 CKL GAPDH MDH UBC10 ACT
NormFinder CKL WD40 MDH UBC GAPDH THFs EF-1α PDI UBC10 ACT
geNorm CKL WD40 MDH UBC THFs PDI GAPDH EF-1α UBC10 ACT
Recommended comprehensive ranking CKL WD40 UBC THFs MDH PDI GAPDH EF-1α UBC10 ACT
Bud/-15°
Delta Ct CKL MDH UBC UBC10 GAPDH WD40 PDI EF-1α THFs ACT
BestKeeper WD40 THFs EF-1α CKL PDI UBC GAPDH MDH UBC10 ACT
NormFinder CKL MDH UBC UBC10 WD40 GAPDH PDI EF-1α THFs ACT
geNorm GAPDH UBC10 MDH CKL WD40 EF-1α UBC PDI THFs ACT
Recommended comprehensive ranking CKL MDH UBC10 WD40 GAPDH UBC EF-1α THFs PDI ACT

References

Adams, I., Harrison, C., Tomlinson, J. and Boonham, N. 2015. Microarray platform for the detection of a range of plant viruses and viroids. . Methods Mol. Biol. 1302: 273-282.
crossref pmid
An, J.-P., Li, R., Qu, F.-J., You, C.-X., Wang, X.-F. and Hao, Y.-J. 2018. R2R3-MYB transcription factor MdMYB23 is involved in the cold tolerance and proanthocyanidin accumulation in apple. Plant J. 96: 562-577.
crossref pmid
An, J.-P., Wang, X.-F., Zhang, X.-W., Xu, H.-F., Bi, S.-Q., You, C.-X. and et al. 2020. An apple MYB transcription factor regulates cold tolerance and anthocyanin accumulation and undergoes MIEL1-mediated degradation. Plant Biotechnol. J. 18: 337-353.
crossref pmid
Andersen, C. L., Jensen, J. L. and Orntoft, T. F. 2004. Normalization of real-time quantitative reverse transcription-PCR data: a modelbased variance estimation approach to identify genes suited for normalization, applied to bladder and colon cancer data sets. Cancer Res. 64: 5245-5250.
crossref pmid
Baek, E., Yoon, J.-Y. and Palukaitis, P. 2017. Validation of reference genes for quantifying changes in gene expression in virusinfected tobacco. Virology. 510: 29-39.
crossref pmid
Broothaerts, W., Van Nerum, I. and Keulemans, J. 2004. Update on and review of the incompatibility (S-) genotypes of apple cultivars. HortScience. 39: 943-947.
crossref
Bustin, S. A., Benes, V., Garson, J. A., Hellemans, J., Huggett, J., Kubista, M. and et al. 2009. The MIQE guidelines: minimum information for publication of quantitative real-time PCR experiments. Clin. Chem. 55: 611-622.
crossref pmid
Chao, A. and Jost, L. 2012. Coverage-based rarefaction and extrapolation: standardizing samples by completeness rather than size. Ecology. 93: 2533-2547.
crossref pmid
Chen, S., Ye, T., Hao, L., Chen, H., Wang, S., Fan, Z. and et al. 2014. Infection of apple by apple stem grooving virus leads to extensive alterations in gene expression patterns but no disease symptoms. PLoS ONE. 9: e95239.
crossref pmid pmc
Cheng, D., Zhang, Z., He, X. and Liang, G. 2013. Validation of reference genes in Solenopsis invicta in different developmental stages, castes and tissues. PLoS ONE. 8: e57718.
crossref pmid pmc
Cho, I.-S., Igori, D., Lim, S., Choi, G.-S., Hammond, J., Lim, H.-S. and et al. 2016. Deep sequencing analysis of apple infecting viruses in Korea. Plant Pathol. J. 32: 441-451.
crossref pmid pmc
Daccord, N., Celton, J.-M., Linsmith, G., Becker, C., Choisne, N., Schijlen, E. and et al. 2017. High-quality de novo assembly of the apple genome and methylome dynamics of early fruit development. Nat. Genet. 49: 1099-1106.
crossref pmid
Gadiou, S. and Kundu, J. K. 2012. Evaluation of reference genes for the relative quantification of apple stem grooving virus and apple mosaic virus in apple trees. Indian J. Virol. 23: 39-41.
crossref pmid pmc
Gapper, N. E., Hertog, M., Lee, J., Buchanan, D. A., Leisso, R. S., Fei, Z. and et al. 2017. Delayed response to cold stress is characterized by successive metabolic shifts culminating in apple fruit peel necrosis. BMC Plant Biol. 17: 77
crossref pmid pmc
Ishihara, T., Sato, Y. and Takahashi, H. 2015. Microarray analysis of Rgene-mediated resistance to viruses. Methods Mol. Biol. 1236: 197-218.
pmid
Jaakola, L. 2013. New insights into the regulation of anthocyanin biosynthesis in fruits. Trends Plant Sci. 18: 477-483.
crossref pmid
Kinard, G. G., Scott, S. W. and Barnett, O. W. 1996. Detection of apple chlorotic leaf spot and apple stem grooving viruses using RTPCR. Plant Dis. 80: 616-621.
crossref
Lee, S.-H., Kwon, Y., Shin, H., Nam, S.-Y., Hong, E. Y., Kim, B. and et al. 2017 Survey on virus infection for commercial nursery trees of major apple cultivars in Korea. Res. Plant Dis. 23: 355-362. (In Korean).
crossref
Lilly, S. T., Drummond, R. S. M., Pearson, M. N. and MacDiarmid, R. M. 2011. Identification and validation of reference genes for normalization of transcripts from virus-infected Arabidopsis thaliana. Mol. Plant-Microbe Interact. 24: 294-304.
crossref pmid
Liu, D., Shi, L., Han, C., Yu, J., Li, D. and Zhang, Y. 2012. Validation of reference genes for gene expression studies in virus-infected Nicotiana benthamiana using quantitative real-time PCR. PLoS One. 7: e46451.
crossref pmid pmc
Ma, C., Liang, B., Chang, B., Yan, J., Liu, L., Wang, Y. and et al. 2019. Transcriptome profiling of anthocyanin biosynthesis in the peel of 'Granny Smith' apples (Malus domestica) after bag removal. BMC Genomics. 20: 353
pmid pmc
Mascia, T., Santovito, E., Gallitelli, D. and Cillo, F. 2010. Evaluation of reference genes for quantitative reverse-transcription polymerase chain reaction normalization in infected tomato plants. Mol. Plant Pathol. 11: 805-816.
crossref pmid pmc
Menzel, W., Jelkmann, W. and Maiss, E. 2002. Detection of four apple viruses by multiplex RT-PCR assays with coamplification of plant mRNA as internal control. . J. Virol. Methods. 99: 81-92.
crossref pmid
Ohira, K., Namba, S., Rozanov, M., Kusumi, T. and Tsuchizaki, T. 1995. Complete sequence of an infectious full-length cDNA clone of citrus tatter leaf capillovirus: comparative sequence analysis of capillovirus genomes. J Gen Virol. 6: 2305-2309.
crossref
Pallas, V. and Garcia, J. A. 2011. How do plant viruses induce disease? Interactions and interference with host components. J. Gen. Virol. 92: 2691-2705.
crossref pmid
Pecman, A., Kutnjak, D., Gutierrez-Aguirre, I., Adams, I., Fox, A., Boonham, N. and et al. 2017. Next generation sequencing for detection and discovery of plant viruses and viroids: comparison of two approaches. Front. Microbiol. 8: 1998
crossref pmid pmc
Pfaffl, M. W., Tichopad, A., Prgomet, C. and Neuvians, T. P. 2004. Determination of stable housekeeping genes, differentially regulated target genes and sample integrity: BestKeeper-Excelbased tool using pair-wise correlations. Biotechnol. Lett. 26: 509-515.
crossref pmid
Postnikova, O. A. and Nemchinov, L. G. 2012. Comparative analysis of microarray data in Arabidopsis transcriptome during compatible interactions with plant viruses. Virol. J. 9: 101
crossref pmid pmc
Reddy, D. S., Bhatnagar-Mathur, P., Cindhuri, K. S. and Sharma, K. K. 2013. Evaluation and validation of reference genes for normalization of quantitative real-time PCR based gene expression studies in peanut. PLoS One. 8: e78555.
crossref pmid pmc
Rocha, A. J., Monteiro, J. E., Freire, J. E. C., Sousa, A. J. S. and Fonteles, C. S. R. 2015. Real time PCR: the use of reference genes and essential rules required to obtain normalisation data reliable to quantitative gene expression. J. Mol. Biol. Res. 5: 45-55.
crossref
Shinozaki, K. and Yamaguchi-Shinozaki, K. 2000. Molecular responses to dehydration and low temperature: differences and crosstalk between two stress signaling pathways. Curr. Opin. Plant Biol. 3: 217-223.
crossref pmid
Shinozaki, K., Yamaguchi-Shinozaki, K. and Seki, M. 2003. Regulatory network of gene expression in the drought and cold stress responses. Curr. Opin. Plant Biol. 6: 410-417.
crossref pmid
Silver, N., Best, S., Jiang, J.Thein, S. L. 2006. Selection of housekeeping genes for gene expression studies in human reticulocytes using real-time PCR. Plant Methods. 15: p. 33
Tang, F., Chu, L., Shu, W., He, X., Wang, L.Lu, M. 2019. Selection and validation of reference genes for quantitative expression analysis of miRNAs and mRNAs in Poplar. Plant Physiol. 142: p. 35
crossref
Takos, A. M., Jaffe, F. W., Jacob, S. R., Bogs, J., Robinson, S. P. and Walker, A. R. 2006. Light-induced expression of a MYB gene regulates anthocyanin biosynthesis in red apples. Plant Physiol. 142: 1216-1232.
crossref pmid pmc
Thakur, P., Kumar, S., Malik, J. A., Berger, J. D. and Nayyar, H. 2010. Cold stress effects on reproductive development in grain crops: an overview. Environ. Exp. Bot. 67: 429-443.
crossref
Vandesompele, J., De Preter, K., Pattyn, F., Poppe, B., Van Roy, N., De Paepe, A. and et al. 2002. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol. 3: research0034.1.
Velasco, R., Zharkikh, A., Affourtit, J., Dhingra, A., Cestaro, A., Kalyanaraman, A. and et al. 2010. The genome of the domesticated apple (Malus . domestica Borkh.). Nat. Genet. 42: 833-839.
pmid
Wan, Q., Chen, S., Shan, Z., Yang, Z., Chen, L., Zhang, C. and et al. 2017. Stability evaluation of reference genes for gene expression analysis by RT-qPCR in soybean under different conditions. PLoS One. 12: e0189405.
crossref pmid pmc
Wang, Z., Chen, Y., Fang, H., Shi, H., Chen, K., Zhang, Z. and et al. 2014. Selection of reference genes for quantitative reverse-transcription polymerase chain reaction normalization in Brassica napus under various stress conditions. Mol. Gen. Genet. 289: 1023-1035.
crossref
Webb, S. 2013. Getting over qPCR's technical hurdles. Biotechniques. 55: 165-168.
crossref pmid
Whitham, T. G., Bailey, J. K., Schweitzer, J. A., Shuster, S. M., Bangert, R. K., LeRoy, C. J. and et al. 2006. A framework for community and ecosystem genetics: from genes to ecosystems. Nat. Rev. Genet. 7: 510-523.
crossref pmid
Wieczorek, P., Wrzesińska, B. and Obrępalska-Stęplowska, A. 2013. Assessment of reference gene stability influenced by extremely divergent disease symptoms in Solanum lycopersicum L. J. Virol. Methods. 194: 161-168.
crossref pmid
Wood, G. A. 1979. Virus and Virus-like Diseases of Pome Fruits and Stone Fruits in New Zealand (DSIR Bulletin 226). Department of Scientific and Industrial Research, Wellington, New Zealand. p. 87.
Wu, Q., Ding, S.-W., Zhang, Y. and Zhu, S. 2015. Identification of viruses and viroids by next-generation sequencing and homology-dependent and homology-independent algorithms. Annu. Rev. Phytopathol. 53: 425-444.
crossref pmid
Zhang, K., Niu, S., Di, D., Shi, L., Liu, D., Cao, X. and et al. 2013. Selection of references genes for gene expression studies in virus-infected monocots using quantitative real-time PCR. J. Biotechnol. 168: 7-14.
crossref
Zhu, L., Yang, C., You, Y., Liang, W., Wang, N., Fengwang, M. A. and et al. 2019. Validation of reference genes for qRT-PCR analysis in peel and flesh of six apple cultivars (Malus domestica) at diverse stages of fruit development. Sci. Hortic. 244: 165-171.
crossref
TOOLS
METRICS Graph View
  • 0 Crossref
  •  0 Scopus
  • 669 View
  • 16 Download
ORCID iDs

Seung-Kook Choi
https://orcid.org/0000-0002-0546-3755

Related articles


ABOUT
BROWSE ARTICLES
EDITORIAL POLICY
FOR CONTRIBUTORS
Editorial Office
Rm,904 (New Bldg.) The Korean Science & Technology Center 22, Teheran-ro 7-gil, Gangnam-gu, Seoul 06130, Korea
Tel: +82-2-557-9360    Fax: +82-2-557-9361    E-mail: paper@kspp.org                

Copyright © 2022 by The Korean Society of Plant Pathology.

Developed in M2PI

Close layer
prev next