Res. Plant Dis > Volume 26(2); 2020 > Article
치즈 유청의 오이모자이크바이러스와 고추모틀바이러스 감염 억제 효과

ABSTRACT

Evaluations were made for the effects of cheese whey treatment on infection of pepper plants by cucumber mosaic virus-Vch (CMV-Vch) and pepper mottle virus-Kr (PepMoV-Kr). In a greenhouse, pepper plants sprayed with whey, prior to inoculation by CMV-Vch using aphids, showed a viral infection rate significantly lower (6.6%) than for the control (23.3%). In an open field experiment, in which CMV infection relied on natural transmission by aphids, pepper plants were sprayed with undiluted whey once a week, starting on the transplanting date (May 2) to the end of June. On June 5, these whey-sprayed plants showed a CMV infection rate reduced by 18.9% and 16.7%, compared to untreated and pesticide-treated plants, respectively. In the greenhouse, pepper plants inoculated with PepMoV-Kr mixed with whey showed a viral infection rate decreased by 60% compared to the control. The accumulated amount of PepMoV-Kr coat protein was less than that for the virus-only control at 6 days post inoculation (dpi), but increased up to a similar level as the control at 9 dpi. This study showed that cheese whey is effective in reducing infection of both CMV and PepMoV in pepper plants.

서 론

현재 바이러스에 감염된 식물을 치료하는 데 사용할 수 있는 약제는 없다. 바이러스 감염을 억제하기 위하여 우유를 식물체에 분무하거나 식물체를 우유에 담그는 방법이 시도되어 왔다(Gillian, 2005). 최근 몇몇 우유 단백질이 바이러스 감염을 억제한다는 보고가 있었다. 특히 lactoferrin의 항바이러스 효과에 관해서는 많은 연구가 이루어졌다. Abdelbacki 등(2010)은 토마토황화잎말림바이러스(tomato yellow leaf curl virus)에 감염된 토마토에 유청의 주요 단백질인 α-lactalbumin, β-lacto-globulin 또는 lactoferrin을 처리한 결과 바이러스 복제가 억제된다고 보고하였다.
치즈 유청은 치즈 가공 과정에서 나오는 부산물로서 다양한 영양학적, 생물학적, 식품학적 기능을 가진 단백질을 함유한 물질로 주요 구성 성분은 α-lactalbumin, β-lactoglobulin, lactoferrin, serum albumin 및 proteose peptones이다(Farrell 등, 2004). 그 동안 유청은 버려지는 것으로 여겨졌으며, 비용을 들여서 폐기하거나 유청 분말과 같은 비교적 저가의 제품을 만드는데 사용하였다.
본 연구에서는 고추에 유청을 분무하여 바이러스 감염을 억제하는 효과가 있는지를 평가하기 위하여, 온실에서 고추모틀바이러스(pepper mottle virus, PepMoV)에 감염된 고추 식물체의 즙액과 유청을 1:1로 혼합하여 고추에 인공 접종하여 시간경과에 따른 외피단백질의 농도 변화를 분석하였다. 그리고 온실에서 오이모자이크바이러스(cucumber mosaic virus, CMV)의 인공접종으로 바이러스 감염 억제 효과를 살펴보고, 노지에서 정식일로부터 유청 원액을 분무 처리하여 자연상태에서 진딧물에 의해 전염되는 CMV 감염을 억제하는 데 효과가 있는지를 조사하였다.

재료 및 방법

식물 재료 및 바이러스 접종원.

노지 및 온실 실험에 사용한 모든 식물 재료는 고추 ’청양’ 품종으로 진딧물 차단 시설이 된 유리온실에서 파종 후 30일된 묘를 사용하였다. 바이러스 접종원은 국립원예특작과학원에서 보유한 cucumber mosaic virus-Vch (CMV-Vch) (Cho 등, 2006)과 pepper mottle virus-Kr (PepMoV-Kr) (data not shown)이며, 고추에 감염시켜서 진딧물 차단을 위한 망 시설이 된 유리온실에서 유지하면서 온실 실험을 위한 바이러스 전염원으로 사용하였다. 노지에서의 시험 처리구는 3개의 블럭으로 나누어서 배치하였으며, 블록당 처리별로 50 그루를 심었다.

바이러스 검정.

CMV 감염 여부에 대한 검정은 정식 20일 후부터 enzyme-linked immunosorbent assay 방법으로 Ag-dia (Elkhart, IN, USA) 제품을 사용하여 제조사에서 권장하는 실험절차대로 수행하였다.
PepMoV의 외피단백질 분석은 바이러스 접종 후 3일부터 9일까지 3일 간격으로 상엽을 채취하여 웨스턴 블로팅 방법을 이용하였으며, 자세한 웨스턴 블로팅 실험 방법은 기 보고대로(Chung 등, 2016) 수행하였다. 1차 항혈청은 국립원예특작과학원에서 제작한 PepMoV-Vch 다클론 항혈청을 사용하였으며, 2차 항혈청은 토끼에서 생산한 IgG와 alkaline phosphatase를 결합시킨 제품(Sigma-Aldrich, St. Louis, MO, USA)을 사용하였다. PepMoV 감염 여부 확인은 처리 10일 후에 접종한 잎 위쪽에 위치한 잎으로부터 RNeasy kit (Qiagen, Hilden, Germany)를 이용하여 추출한 식물체 전체 RNA와, PepMoV 외피단백질을 증폭하도록 제작된 PepMoV-819F (AGCAGCTCAAGATCAGACACATTG)와 PepMoV-819R (CATTTCCCTGACCCCAAGCAAGGT) 프라이머를 사용하여, reverse transcription-polymerase chain reaction 방법으로 수행하였다.

유청 처리.

유청은 국립축산과학원으로부터 스트링치즈 제조 과정에서 나온 것을 분양 받아서 사용하였다(Supplementary Table 1). 온실에서의 실험은 유청 원액을 물로 2-20배 희석하여 처리하였다. 노지재배지에서 유청의 처리는 희석하지 않고 원액을 고추 ’청양’ 품종에 정식 직후부터 1주일 간격으로 약 2개월(5월2일-6월30일) 동안 분무 처리하였다. 분무 방법은 식물체 잎으로부터 유청액이 한두 방울 떨어지는 정도로 하였으며, 식물체 크기에 따라 한 그루를 뿌리는 데 소요되는 양은 달랐으며, 초장 30, 60, 90 cm 크기의 식물체의 경우 각각 약 15, 20, 30 ml가 소요되었다. 대조는 유청 대신에 물을 사용하였다. 유청의 PepMoV 억제 효과를 보기 위한 실험에서는 바이러스에 감염된 고추 잎의 즙액(0.5 M phosphate buffered saline [PBS], pH 7.2=1:5, w/v)과 유청 원액을 1:1로 혼합하여 접종하였다. 대조로 살충제 처리를 하였다. 살충제는 세티스 입상수화제(FarmHannong, Seoul, Korea)를 사용하였으며, 처리 농도는 제조사의 권장 사용법대로 사용하였다.

바이러스 접종 방법.

온실 실험은 유청을 뿌린 후 1시간 30분-2시간 후에 CMV-Vch를 접종하였다. 접종 방법은 바이러스를 먹인 복숭아혹진딧물(Myzus persicae) 2-3령 충을 잎에 그루당 5마리씩 올려 놓았으며, 진딧물 접종에 관한 자세한 방법은 기 보고(Chung 등, 2013) 대로 수행하였다. 노지 재배지에서는 CMV를 인위적으로 접종하지 않고 자연감염되도록 두었다. PepMoV의 인공 접종은 바이러스에 감염된 고추 잎의 즙액(0.5 M PBS, pH 7.2=1:5, w/v)과 유청 원액을 1:1로 혼합하여 20분 동안 상온에 둔 후 잎 2매에 면봉을 이용하여 문질러서 접종하였다.

노지 정식 방법 및 진딧물 밀도 조사.

파종 2개월된 고추 청양 품종을 5월 2일에 전라북도 완주군 이서면 소재 국립원예특작과학원 노지 시험 포장에서 50 cm 간격으로 정식하였다. 시험 포장 주변의 진딧물 밀도를 조사하기 위하여 4월 24일부터 시험 포장 주변에 6개의 노란색 끈끈이 트랩을 설치하여 트랩 별 진딧물 수를 매주 조사하였다.

결 과

PepMoV에 감염된 고추 식물체 즙액과 유청을 1:1로 혼합하여 온실에서 고추에 인공 접종한 결과, 바이러스 감염률이 대조에 비하여 60% 감소하였다(Table 1). PepMoV 접종 후의 외피단백질 축적 양을 웨스턴 블로팅 방법으로 분석한 결과, 접종 6일후 대조에 비하여 외피단백질 축적 양이 적었으나, 접종 9일후에는 대조와 동일하게 증가하였다(Fig. 1)
온실에서 고추 ‘청양’ 품종에 유청 원액의 농도를 2-20배로 희석하여 분무 처리한 후 복숭아혹진딧물을 이용하여 CMV를 접종한 결과, 바이러스 감염률이 대조로 물을 처리한 경우 23.3%인 반면 유청의 원액 처리에서는 6.6%로 저하되었다 (Table 1). 유청의 원액을 2-20배 배율로 물로 희석하여 처리한 경우 유청 원액 처리와 비교하여 유의성 있는 차이를 보이지는 않았으나, 희석 배율이 높을수록 감염률이 다소 높은 것을 볼 수 있다(Table 1).
고추 재배지 주변에 설치한 진딧물 포획용 끈끈이 트랩의 진딧물 밀도는 5월 15일에 최고를 보였으며, 5월 22일 이후 CMV 감염주율이 무처리에서 급격히 증가한 반면(Fig. 2A), 유청 처리구에서는 감염률이 완만히 증가하는 것을 볼 수 있다(Fig. 2B). 5월23일부터 2주일 간격으로 7월 18일까지 바이러스 감염률을 조사한 결과, 6월5일 바이러스 검정일 까지 양성반응을 보인 식물체의 비율이 유청 처리구가 무처리와 살충제 처리에 비해 각각 18.9%와 16.7% 낮았다(Fig. 3). 한편, 이 시기의 무처리와 살충제 처리구 간의 CMV 감염률 차이는 2.2%로 크지 않았다(Fig. 3).

고 찰

본 연구에서 PepMoV의 경우 유청과 바이러스 접종원을 혼합하여 인공 접종시 바이러스 감염률이 대조에 비해 낮았으며, 또한 접종 6일째에는 외피단백질 축적 양이 적었으나 접종 9일째에는 대조와 동일한 수준으로 증가하였다. 이 결과로 보아 유청은 바이러스가 식물의 세포 속으로 침투하는 것을 방해하거나활성을 억제하여 식물체가 바이러스에 감염되는 것을 억제하는 것으로 추정된다. 감염 초기에 바이러스 축적이 낮은 것으로 보아 유청으로 인해 바이러스가 침입하는 시점에서 바이러스 활성이 억제되는 것으로 보인다. 또한 바이러스 접종 후 시간이 지남에 따라 유청을 처리한 식물체의 바이러스 축적이 대조와 동일한 것으로 보아, 유청이 세포 속으로 침투 이행하여지속적으로 바이러스 증식을 억제하는 것은 아닌 것으로 보인다. 이 결과는 앞선 연구(Abdelbacki 등, 2010)에서 유청이 바이러스가 식물체에 침입하는 것을 방해하는 것으로 보인다는 결과와 동일하다. 기 보고(Abdelbacki 등, 2010)에서 lactoferrin또는 α-lactoglobulin을 토마토황화잎말림바이러스에 감염된 토마토에 처리하였을 때 바이러스 복제가 억제되었는데, 이는 세포막으로 바이러스가 침입하는 부위를 lactoferrin 또는 α-lactoglobulin이 방해하거나, 또는 침입부위에 lactoferrin 또는α-lactoglobulin 물질이 채워지는 것과 관련이 있다고 하였다(Abdelbacki 등, 2010).
Hu 등(1994)의 연구에서는 탈지분유가 심비디움모자이크바이러스(cymbidium mild mosaic virus, CymMV) 감염에 의해 접종한 잎에만 병반을 형성하는 기주에는 바이러스 감염 억제효과가 있었는데, 이는 탈지분유에 있는 단백질 분해 효소로 인한 바이러스의 분해에 의한 것보다는 바이러스와 덩어리를 이루기 때문으로 추정하였다. 한편 전신 감염 기주인 덴디로비움 난에서는 CymMV 활성 억제 효과가 없었다.
유청의 주요 성분은 α-lactalbumin, β-lactoglobulin 및 lactoferrin 등이 있다(Zapata 등, 2017). 1987년 lactoferrin 이 Friend leukaemia virus (FLV)에 감염된 쥐에게 방어효과가 있다(Lu 등, 1987)는 보고가 있은 후 lactoferrin의 항 바이러스 효과에 관한 많은 연구가 이루어졌다. Lactoferrin의 항 바이러스 기작에 관한 두가지 주장은 세포 표면의 glycosaminoglycans 같은 수용체와의 상호작용(Mann 등, 1994; Wu 등, 1995)과 lac-toferrin이 바이러스 입자에 직접 결합해서 기주 세포로 바이러스 입자가 흡착하는 것을 억제한다는 것이다(Marchetti 등, 1996; Superti 등, 1997; Swart 등, 1996; Yi 등, 1997).
한편 lactoferrin이 인체감염 바이러스인 거대세포바이러스(cytomegalovirus) 감염에 효과가 있다는 것이 많은 연구자들에 의해 보고되었다(Clarke과 May, 2000; Harmsen 등, 1995; Hasegawa 등, 1994; Shimizu 등, 1996; Swart 등, 1999). 이 보고들에 의하면 lactoferrin이 바이러스가 기주 세포로 침입하는 것을 방해하며, 감염 동안에 체내 바이러스 증식을 억제한다(Andersen 등, 2001) 고 하였다. 또한 lactoferrin과 같은 항 바이러스 단백질의 전하가 상호작용에 중요한 역할을 하게 되기 때문에 우유단백질의 전하를 바꾸어서 항 바이러스 특성을 향상시키려는 시도도 이루어졌다(Harmsen 등, 1995; Waarts 등, 2005).
본 연구의 노지 실험 포장 주변에 설치한 진딧물 포획용 끈끈이트랩으로 진딧물 밀도를 조사한 결과에 의하면 완주군 지역에서 5월 중순에 진딧물의 밀도가 최고가 되었으며 CMV 발생은 진딧물 최고 밀도를 보인지 7일 이후부터 6월 중순까지급격히 증가하는 경향을 보여주었다. 유청 처리로 인해 무처리또는 살충제 처리에 비해 정식 1개월까지의 CMV 초기 감염률이낮았으나, 7월4일까지의 검정에서 양성반응을 보인 식물체의 비율은 세 처리 모두에서 유사하였는데, 정식 초기에는 묘가 작아서 유청이 충분히 도포된 반면 식물체가 자란 이후에는 유청이 충분하게 도포 되지 않았을 가능성, 또는 외기 온도가 올라가서 고추가 바이러스 감염에 유리한 조건이 되어 유청의 효과가 저하되었을 가능성이 있을 것으로 추정된다. 기 보고(Chung 등, 2015)에서 배추가 순무모자이크바이러스(turnip mosaic virus, TuMV) 감염 시 10°C부터 23°C까지 온도가 상승함에 따라 식물체의 바이러스에 의한 전신 감염속도가 빨랐다.이는 본 연구에서 6월 이후 온도 상승이 바이러스 활성 증가에기여하였을 것으로 추정하게 하는 결과이다. 또한 PepMoV를유청과 혼합하여 인공 접종한 실험에서 감염 억제효과가 있는것으로 보아, 노지에서 고추에 유청 스프레이에 의한 바이러스감염 억제 효과 또한 진딧물의 섭식 활동을 방해에 의한 것이라기 보다는 잎에 살포된 유청으로 인해 진딧물이 고추 식물체를가해하는 동안에 구침에 있는 바이러스의 활성에 영향을 받기때문일 것으로 판단된다.
무처리와 살충제 처리구의 바이러스 감염률 차이가 크지 않은 것을 볼 수 있는데 이는 진딧물 밀도가 높은 시기에는, 약제를 살포하는 동안에 유시충 진딧물이 농약을 피해서 날랐다가 다시 방문하여 전염을 시키기 때문으로 추정되었다. 따라서 진딧물 밀도가 높고 재배지에 CMV 전염원이 많은 시기에는 바이러스병 방제에 살충제 처리 효과가 크지 않을 것으로 판단되었다.
본 결과는 유청의 분무 처리가 노지에서 진딧물에 의해 전염되는 식물 바이러스에 의한 초기 감염을 일부 억제하는 데 효과가 있다는 것을 보여준다.

요 약

치즈 제조공정에서 나오는 부산물인 유청이 진딧물에 의해 전염되는 오이모자이크바이러스(cucumber mosaic virus, CMV)와 고추모틀바이러스(pepper mottle virus, PepMoV)의감염 억제효과가 있는지를 고추 ‘청양’ 품종을 대상으로 조사하였다. 온실에서 유청 원액 및 원액을 물로 2-20배로 희석하여 고추 ‘청양’ 품종에 분무한 후 복숭아혹진딧물을 이용하여 CMV-Vch를 접종한 결과, 원액을 처리한 실험 구의 감염률이6.6%로, 대조로 물을 처리한 실험 구의 감염률 23.3%에 비해저하되었다. 노지에서 재배하는 고추 ‘청양’ 품종에 CMV는 인위적으로 접종하지 않고 자연 감염되도록 둔 상태에서 정식일부터 6월 말일까지 1주일 간격으로 유청 원액을 분무 처리한 결과, 6월5일 이전에 자연적으로 CMV에 감염된 식물체의 비율이무처리와 살충제 처리에 비해 각각 18.9%와 16.7% 감소하였다.유청의 식물 바이러스 감염억제에 대한 작용 기작을 알기 위하여 온실에서 PepMoV-kr에 감염된 식물체 즙액과 유청을 1:1로혼합하여 고추에 인공접종하여 시간경과에 따른 외피단백질농도 변화를 웨스턴 블로팅 방법으로 분석한 결과, 접종 6일 후대조에 비하여 적었으나, 접종 9일 후에는 대조와 동일하게 증가하였다. 본 연구 결과는 유청이 고추에 발생하는 서로 다른속에 속하는 두 종류의 바이러스인 CMV와 PepMoV에 의한 감염 억제에 효과가 있다는 것을 보여주었다.

Electronic Supplementary Material

Supplementary materials are available at Research in Plant Disease website (http://www.online-rpd.org/).

NOTES

Conflicts of Interest

No potential conflict of interest relevant to this article was reported.

Fig. 1
Western blot analysis of the accumulation of coat protein (CP) of pepper mottle virus-Kr (PepMoV-Kr) within the upper leaves of pepper plants inoculated with a mixture of PepMoV-Kr-infected plant sap and cheese whey (1:1). Samples were collected at three-day intervals starting at 3 days post inoculation (dpi) and ending at 9 dpi. Fewer plants were infected and lower amounts of CP were detected in whey-treated plants; however, at 9 dpi, the accumulation of CP was similar to water-treated plants. Each western blot lane (1-8) represents an extract from a single plant. The lanes labeled PC contain an extract from a PepMoV-Kr-infected plant (positive control). The lanes labeled M contain molecular weight markers, the sizes of which (in kD) are indicated to the left of the blots. The panels below the western blots show blotted ponceau S solution (Sigma)-stained membranes prior to antibody incubation (loading controls).
RPD-26-103-f1.jpg
Fig. 2
Percentage of pepper plants infected with cucumber mosaic virus (CMV) naturally in open fields. Pepper plants were sprayed with undiluted whey once a week starting on the transplanting date (May 2) to the end of June. Virus tests were performed every 2 weeks starting May 23 and ending July 18. (A) Un-treated plants showing a sharp increase of CMV-Vch infection (arrow). (B) Cheese whey-sprayed plants showing a slow increase of CMV-Vch infection (arrow).
RPD-26-103-f2.jpg
Fig. 3
Percentage of pepper plants infected with cucumber mosaic virus (CMV) naturally in open fields over time after planting. Pepper plants were sprayed with undiluted whey once a week starting on the transplanting date (May 2) to the end of June. Virus tests were performed every two weeks starting May 23 and ending July 18. The percentage of plants testing positive for CMV until the test date of June 5 decreased by 18.9% and 16.7% in cheese whey sprayed plants compared with un-treated or pesticide-treated plants, respectively.
RPD-26-103-f3.jpg
Table 1
Percentage of pepper plants infected with cucumber mosaic virus-Vch (CMV-Vch) or pepper mottle virus-Kr (PepMoV-Kr)
Dilution factor of cheese whey No. of plants treated % of plants infected


CMV-Vch PepMoV-Kr CMV-Vch PepMoV-Kr
70 20 6.6±4.32 ba 40.0 b
0.5× 66 20 11.5±2.66 ab 100.0 a
0.1× 70 20 10.9±5.48 ab 100.0 a
0.05× 70 20 10.2±5.95 ab 100.0 a
Water (control) 70 20 23.3±9.73 a 100.0 a

Pepper plants were either sprayed with cheese whey before inoculation with CMV-Vch using Myzus persicae, or mechanically inoculated with PepMoV-Kr mixed with whey (1:1).

a Means with the same letters within a column are not significantly different (Duncan’s multiple range test, P<0.05).

References

Abdelbacki, A. M., Taha, S. H., Sitohy, M. Z., Abou Dawood, A. I., Abd-El Hamid, M. M. and Rezk, A. A. 2010. Inhibition of Tomato Yellow Leaf Curl Virus (TYLCV) using whey proteins. Virol. J 7: 26
crossref pmid pmc
Andersen, J. H., Osbakk, S. A., Vorland, L. H., Traavik, T. and Gutteberg, T. J. 2001. Lactoferrin and cyclic lactoferricin inhibit the entry of human cytomegalovirus into human fibroblasts. Antiviral Res 51: 141-149.
crossref pmid
Cho, J.-D., Lee, S.-H., Kim, J.-S., Choi, G.-S., Kim, H.-R., Chung, B.-N. et al. 2006. Characteristics of Cucumber mosaic virus-VCH causing vein chlorosis on red pepper in Korea. Res. Plant Dis 12: 226-230. (In Korean)
crossref
Chung, B. N., Canto, T., Tenllado, F., Choi, K. S., Joa, J. H., Ahn, J. J. et al. 2016. The effects of high temperature on infection by Potato virus Y, Potato virus A, and Potato leafroll virus. Plant Pathol. J 32: 321-328.
crossref pmid pmc
Chung, B. N., Choi, K. S., Ahn, J. J., Joa, J. H., Do, K. S. and Park, K.-S. 2015. Effects of temperature on systemic infection and symptom expression of Turnip mosaic virus in Chinese cabbage (Brassica campestris). Plant Pathol. J 31: 363-370.
crossref pmid pmc
Chung, B. N., Yoon, J.-Y. and Palukaitis, P. 2013. Engineered resistance in potato against potato leafroll virus, potato virus A and potato virus Y. Virus Genes 47: 86-92.
crossref pmid
Clarke, N. M. and May, J. T. 2000. Effect of antimicrobial factors in human milk on rhinoviruses and milk-borne cytomegalovirus in vitro. J. Med. Microbiol 49: 719-723.
crossref pmid
Farrell, H. M., Jimenez-Flores, R., Bleck, G. T., Brown, E. M., Butler, J. E., Creamer, L. K. et al. 2004. Nomenclature of the proteins of Cows' milk -sixth revision. J. Dairy Sci 87: 1641-1674.
crossref pmid
Gillian, F. 2005. Milk as a management tool for virus diseases. URL http://www.omafra.gov.on.ca/english/crops/hort/news/grower/2005/11gn05a1.htm 23 June 2020.
Harmsen, M. C., Swart, P. J., de Bethune, M.-P., Pauwels, R., De Clercq, E., The, T. B. et al. 1995. Antiviral effects of plasma and milk proteins: lactoferrin shows potent activity against both human immunodeficiency virus and human cytomegalovirus replication in vitro. J. Infect. Dis 172: 380-388.
crossref pmid
Hasegawa, K., Motsuchi, W., Tanaka, S. and Dosako, S. 1994. Inhibition with lactoferrin of in vitro infection with human herpes virus. Jpn. J. Med. Sci. Biol 47: 73-85.
crossref pmid
Hu, J. S., Ferreira, S., Xu, M. Q., Lu, M., Iha, M., Pflum, E. et al. 1994. Transmission, movement and inactivation of Cymbidium mosaic and Odontoglossum ringspot viruses. Plant Dis 78: 633-636.
crossref
Lu, L., Hangoc, G., Oliff, A., Chen, L. T., Shen, R. N. and Broxmeyer, H. E. 1987. Protective influence of lactoferrin on mice infected with the polycythemia-inducing strain of Friend virus complex. Cancer Res 47: 4184-4188.
pmid
Mann, D. M., Romm, E. and Migliorini, V. 1994. Delineation of the glycosaminoglycan-binding site in the human inflammatory response protein lactoferrin. J. Biol. Chem 269: 23661-23667.
crossref pmid
Marchetti, M., Longhi, C., Conte, M. P., Pisani, S., Valenti, P. and Seganti, L. 1996. Lactoferrin inhibits herpes simplex virus type 1 adsorption to Vero cells. Antiviral Res 29: 221-231.
crossref pmid
Shimizu, K., Matsuzawa, H., Okada, K., Tazume, S., Dosako, S., Kawasaki, Y. et al. 1996. Lactoferrin-mediated protection of the host from murine cytomegalovirus infection by a T-cell-dependent augmentation of natural killer cell activity. Arch. Virol 141: 1875-1889.
crossref pmid
Superti, F., Ammendolia, M. G., Valenti, P. and Seganti, L. 1997. Antirotaviral activity of milk proteins: lactoferrin prevents rotavirus infection in the enterocyte-like cell line HT-29. Med. Microbiol. Immunol 186: 83-91.
crossref pmid
Swart, P. J., Harmsen, M. C., de Bethune, M. P., Pauwels, R., De Clercq, E., The, T. H. et al. 1996. Antiviral effects of plasma and milk proteins: lactoferrin shows potent antiviral activity on both HIV and HCMV replication in vitro in the same concentration range. Antiviral Res 30: A35. (Abstract)
crossref
Swart, P. J., Harmsen, M. C., Kuipers, M. E., Van Dijk, A. A., Van Der Strate, B. W. A., Van Berkel, P. H. C. et al. 1999. Charge modification of plasma and milk proteins results in antiviral active compounds. J. Pept. Sci 5: 563-576.
crossref pmid
Waarts, B.-L., Aneke, O. J. C., Smit, J. M., Kimata, K., Bittman, R., Meijer, D. K. F. et al. 2005. Antiviral activity of human lactoferrin: inhibition of alphavirus interaction with heparan sulfate. Virology 333: 284-292.
crossref pmid
Wu, H. F., Monroe, D. M. and Church, F. C. 1995. Characterization of the glycosaminoglycan-binding region of lactoferrin. Arch. Biochem. Biophys 317: 85-92.
crossref pmid
Yi, M., Kaneko, S., Yu, D. Y. and Murakami, S. 1997. Hepatitis C virus envelope proteins bind lactoferrin. J. Virol 71: 5997-6002.
crossref pmid pmc
Zapata, R. C., Singh, A., Pezeshki, A., Nibber, T. and Chelikani, P. K. 2017. Whey protein components - lactalbumin and lactoferrin - improve energy balance and metabolism. Sci. Rep 7: 9917
crossref pmid pmc
TOOLS
METRICS Graph View
  • 1 Crossref
  • 1  
  • 4,370 View
  • 111 Download
Related articles


ABOUT
BROWSE ARTICLES
EDITORIAL POLICY
FOR CONTRIBUTORS
Editorial Office
Rm,904 (New Bldg.) The Korean Science & Technology Center 22, Teheran-ro 7-gil, Gangnam-gu, Seoul 06130, Korea
Tel: +82-2-557-9360    Fax: +82-2-557-9361    E-mail: paper@kspp.org                

Copyright © 2026 by The Korean Society of Plant Pathology.

Developed in M2PI

Close layer
prev next