Res. Plant Dis > Volume 22(1); 2016 > Article
속속이풀에서 분리한 고추마일드모틀바이러스와 오이모자이크바이러스의 계통발생학적 특성

요 약

2014년도 충남 당진의 고추포장 바이러스 발생 조사 중, 포장 주변에서 바이러스 병징을 보이는 속속이풀을 수집하였다. 수집한 시료에 대해 여러 고추감염바이러스의 감염 여부를 조사한 결과, PMMoV와 CMV에 복합감염되어 있음을 확인하였다. 이는 PMMoV의 잡초 기주로서 속속이풀의 최초 동정이며, 속속이풀의 CMV 감염의 국내 첫 보고이다. 따라서 이들 신규 분리주들의 계통발생학적 위치를 파악하고자, 이들의 전체 게놈 염기서열을 분석하였고 이미 보고된 PMMoV 및 CMV 분리주의 유전정보와 비교 분석하였다. 유전적 측면에서 이미 보고된 고추감염바이러스와의 관계를 알아보고자 속속이풀에서 분리된 PMMoV와 CMV의 전체 염기서열을 분석하였고, 이들의 계통발생학적 특성을 구명하였다. 그 결과, 속속이풀에서 분리한 PMMoV 및 CMV의 분리주가 고추에서 분리한 분리주들과 매우 높은 유사성을 보임을 확인하였고, 이는 속속이풀이 PMMoV 및 CMV의 중간 기주로 작용할 수 있음을 시사한다.

ABSTRACT

During a field survey in 2014, a Rorippa palustris plant showing virus-like symptom was collected from a pepper field in Dangjin in Korea. The collected sample was subjected to examine infection with pepper-infecting viruses. Molecular diagnosis assay showed that the collected R. palustris sample was co-infected with Pepper mild mottle virus (PMMoV) and Cucumber mosaic virus (CMV). This is the first identification of PMMoV from R. palustris and the first report of CMV infection of R. palustris in Korea. To examine phylogenetic positions of the identified PMMoV and CMV isolates, their complete genome sequences of were determined and compared with those of previously reported isolates of the cognate viruses. Phylogenetic analyses revealed the isolates of PMMoV and CMV obtained from R. palustris are closely related to the pepper isolates of the cognate viruses. Our results suggest that R. palustris could act a weed reservoir of PMMoV and CMV.

서론

잡초는 식물 바이러스병의 생태학적 측면에서 바이러스병 전반을 매개하는 주요 중간 기주로 알려져 있다. 잡초는 바이러스의 중간 기주 또는 월동장소로 이용될 뿐만 아니라 바이러스를 전반하는 매개 해충의 서식장소로 작용하며 바이러스 전염원의 역할을 한다(Coutts 등, 2009; Rist와 Lorbeer, 1991). 다년생 잡초의 경우, 오랜 기간 바이러스의 저장장소로 이용되므로 바이러스 감염에 대한 주의가 요구되며, 특히 일부 잡초 기주는 종자에서도 바이러스가 검출되므로 종자번식 시 계속해서 바이러스를 전반할 가능성이 있다(Edwardson과 Christie, 1986). 따라서 작물 재배 시 바이러스병 방제를 위해 포장 주변의 바이러스 감수성 잡초에 대한 관리가 필요하다.
고추는 바이러스병에 의한 피해가 높은 작물로, 국내에서는 16종의 바이러스가 보고되었으며, 그 중 오이모자이크바이러스(Cucumber mosaic virus, CMV), 잠두위조바이러스2 (Broad bean wilt virus 2, BBWV2), 고추마일드모틀바이러스(Pepper mild mottle virus, PMMoV), 고추모틀바이러스(Pepper mottle virus), 감자바이러스 Y (Potato virus Y), 토마토반점위조바이러스(Tomato spotted wilt virus, TSWV)에 의한 감염 빈도가 가장 높게 나타난다(Kim 등, 2011). 이들 바이러스들은 주로 접촉 및 해충에 의해 전반되므로 고추재배지 주변 잡초의 관리가 바이러스병 발생 빈도와 관련이 있다. 이들 바이러스 중 CMV의 경우 55종의 잡초 기주가 이미 미국에서 보고된 바 있으며(Hobbs 등, 2000), 국내에서도 BBWV2의 잡초 기주로 쇠무릎(Achyranthes japonica)이 보고되었고, TSWV의 경우도 쇠별꽃(Stellaria aquatis), 별꽃(Stellaria media)이 잡초 기주로 보고된 바 있다(Kwon 등, 2000; Lian 등, 2013). 속속이풀(Rorippa palustris)은 십자화과에 속하는 개갓냉이속 2년생 잡초로, 국내 야생지에서 서식하는 잡초의 주요 종으로 알려져 있다. 국내 기록에 의하면 R. palustrisR. islandica 두 종이 모두 속속이풀로 불리는데 R. islandica는 국내에서 순무모자이크바이러스(Turnip mosaic virus)의 잡초 기주로 보고된 바 있으며(Choi 등, 1994), R. palustrisR. indica와 더불어 CMV의 잡초 기주로 보고된 바 있다(Hobbs 등, 2000). 2014년 충남 당진의 고추재배 포장 및 주변 야생지에서 바이러스 증상을 나타내는 속속이풀을 채집하여 다양한 고추감염바이러스에 대한 감염 여부를 reverse transcription-polymerase chain reaction (RT-PCR)을 통해 조사한 결과, PMMoV와 CMV의 복합 감염이 확인되었다. 본 연구에서는 PMMoV의 잡초 기주로서 속속이풀을 세계 최초로 동정했으며, 속속이풀의 CMV 감염을 국내에서는 처음으로 확인하였다. 따라서 유전적 측면에서 이미 보고된 고추감염바이러스와의 관계를 알아보고자, 속속이풀에서 분리된 PMMoV와 CMV의 전체 염기서열을 분석하였고 이들의 계통발생학적 특성을 구명하였다.

재료 및 방법

시료 채집 및 바이러스 동정

2014년 10월 충남 당진 고추포장 및 주변 야생지에서 약한 모자이크 병징과 황화 증상을 보이는 속속이풀을 채집하였다(Fig. 1A). 바이러스 감염 여부를 확인하기 위해 먼저 병징을 보이는 잎으로부터 PureLink™ RNA mini-kit (Ambion, Austin, TX, USA)를 이용하여 Total RNA를 추출하였다. 감염바이러스의 확인을 위한 RT-PCR은 Access Quick RT-PCR system (Promega, Madison, WI, USA)과 고추 바이러스 진단 특이 프라이머(Table 1)를 이용하여 실시하였다.
Fig. 1
(A) Symptomatic leaves of Rorippa palustris co-infected with Pepper mild mottle virus (PMMoV) and Cucumber mosaic virus (CMV). The leaf samples were collected from Dangjin in 2014. (B) RT-PCR detection of PMMoV and CMV from the symptomatic of R. palustris. The sample was subjected to detect 6 pepper-infecting viruses as indicated on the top of the image using the specific primer pairs (Table 1). PCR amplicons were visualized under ultraviolet light in 1% agarose gel containing 1 μg/ml ethidium bromide. BBWV2, Broad bean wilt virus 2; PVY, Potato virus Y; PepMoV, Pepper mottle virus; TSWV, Tomato spotted wilt virus; NC, negative control.
RPD_22_025_fig_1.jpg
Table 1
List of the detection primers specific for each pepper-infecting virus
 Virus  Primer    Primer sequence (5’ → 3’)
CMV CMV Fwd ATGGACAAATCTGAATCAACCAGTGCTGGT
CMV Rev TCAGACTGGGAGCACTCCAGATGTGGG
BBWV2 BBWV2 Fwd AAACAAACAGCTTTCGTTCCG
BBWV Rev GCCATCTCATTGGCATGGA
PepMoV PepMoV Fwd TTGAATGTGGTACATATGAAG
PepMoV Rev CATATAATAATATTTCATCCC
PMMoV PMMoV Fwd GAKTCWKCTTCGTTTTAACT
PMMoV Rev AACTTATTTWYRCCATCATGT
TSWV TSWV Fwd ATGTCTAAGGTTAAGCTCAC
TSWV Rev TCAAGCAAGTTCTGCGAGTT
PVY PVY Fwd TGGTGCATTGARAATGGAACCTC
PVY Rev GTCTCCTGATTGAAGTTTACAAG

CMV, Cucumber mosaic virus; BBWV2, Broad bean wilt virus 2; PepMoV, Pepper mottle virus; PMMoV, Pepper mild mottle virus; TSWV, Tomato spotted wilt virus; PVY, Potato virus Y.

바이러스 전체 게놈 증폭

바이러스 전체 게놈 증폭을 위해 cDNA 합성은 3’ 말단의 특이 프라이머(PMMoV 3’ Rev, 5’-GAAAAATAATTACGTCGTTCGC-3’; CMV1&2 Rev, TGGTCTCCTTWTGGAGRCC-3’; CMV3 Rev, 5’-TGGTCTCCTTW TRGAGRMCC-3’)와 Superscript III RTase (Invitrogen, Carlsbad, CA, USA)를 이용하였다. 각 cDNA의 PCR 증폭은 Platinum Taq DNA polymerase (Invitrogen)를 이용하여 실시하였고, 전체 유전자 증폭에 대한 5’ 말단 프라이머(PMMoV 5’ Fwd, 5’-GGCTTACACACAACAAGCTACC-3; CMV1&2 Fwd, 5’-GTTTATTTACAAGAGCGTACGGTTC-3’; CMV3 Fwd, 5’-GTAATCTTACCACTKTGTKTG-3’)와 cDNA 합성에 이용한 3’ 말단 프라이머를 이용하였다. 증폭된 전체 유전자는 QIAquick gel extraction kit (QIAGEN, Hilden, Germany)를 이용하여 정제하였다. 각 PCR 산물은 pGEM-T Easy Vector (Promega)에 클로닝한 후 Bioneer (Daejeon, Korea)에 의뢰하여 시퀀싱하였고, 각 바이러스 및 RNA 단편에 대한 시퀀싱 프라이머는 Table 2에 요약하였다. 각 바이러스의 말단 염기서열은 5’과 3’ rapid amplification cDNA ends-PCR (RACE-PCR) 방법에 의해 분석하였다(Kwon 등, 2014). 시퀀싱에 의해 분석된 각 염기서열은 DNAstar program (DNASTAR, Madison, WI, USA)의 MegAlign과 BioEdit sequence alignment editor를 이용하여 전체 염기서열을 결정하였고 각 염기서열을 National Center for Biotechnology Information (NCBI)의 GenBank에 다음과 같은 accession No. (PMMoV, KR108206; CMV RNA1, KT310080; CMV RNA2, KT310081; CMV RNA3, KT310082)로 등록하였다.
Table 2
List of sequencing primers for determination of complete genome sequences of PMMoV and CMV
 Virus  Primer    Primer sequence (5’ → 3’)
PMMoV 5’ Fwd GGCTTACACACAACAAGCTACC
1281-1238 Fwd CGAGGGGAAAAGGTTAGCAAG
1320-1295 Rev GTAAGTAAGCGCTTTCGACTGGTATG
2391-2411 Fwd GTGCTTTGTTGCGCTTCTCAC
2552-2531 Rev GCACTGCTTATATGGGGTTCAC
3591-3614 Fwd GAATGTCAAGGATTGTGTGTTGGA
3793-3772 Rev GAGAAGCGGTGTCTTCGATGTC
5018-5040 Fwd CGAAAGTTGACAAAGTGATTGCA
5134-5111 Rev CGGACACAACTAACCCTGCTAAAC
3’Rev GAAAAATAATTACGTCGTTCGC
CMV R1&2 Fwd GTTTATTTACAAGAGCGTACGGTTC
R1_923-946 Fwd ATGTCTTATGTTCATGATTGGGAG
R1_1104-1079 Rev GGGAACCAAATACAATGTCGAATGAG
R1_1946-1969 Fwd GGCGGTGATGACAAAAGAAACTCC
R1_2074-2051 Rev ACCCTCGGGCACAGGACGCATCCA
R1_2798-2821 Fwd ACGATGACCCAAGCTGATAAGGCC
R1_3011-3032 Rev CACCACAGTACTCGTAGCGGAA
R2_946-970 Fwd GTGACTCGACTCTGCCCACTCATAG
R2_1054-1030 Rev GACTGTCGAAGTCTAACATGATCCA
R2_1979-2004 Fwd CAACATGGAAGCTAAGGTGATGGAAC
R2_2065-2088 Rev CCTCGCGCAATGGATCTGGAACGG
R1&2 Rev TGGTCTCCTTWTGGAGRCC
R3 Fwd GTAATCTTACCACTKTGTKTG
R3_222-244 Fwd ATGGCTACTGAGTGTGACCTAGG
R3_314-291 Rev ACCGTGGGTTACTTCGGGAACGAG
R3_1155-1177 Fwd TCTCATGGATGCTTCTCCGCGAG
R3_1280-1257 Rev ACTGGTTGATTCAGATTTGTCCAT
R3 Rev TGGTCTCCTTWTRGAGRMCC

PMMoV, Pepper mild mottle virus; CMV, Cucumber mosaic virus.

계통발생학적 유연관계분석

각 바이러스에 대한 유연관계 분석 및 계통발생학적 특성을 알아보기 위해 NCBI에 PMMoV와 CMV의 분리주에 대한 염기서열 정보를 수집하였다. 고추에서 분리된 PMMoV와 CMV 분리주를 중심으로 활용하였고 각각의 outgroup으로는 Tobacco mosaic virus (TMV, GenBank accession No.: X68110)와 Peanut stunt virus (PSV RNA1, GenBank accession No.: JN135294; PSV RNA2, GeneBank accession No.: JN135293; PSV RNA3, GenBank accession No.: JN135292)를 사용하였다. Phylogenetic tree 작성을 위해 전체 분리주의 염기서열 배열은 ClustalW를 이용하였고, 계통분석은 MEGA 6 program의 neighbor-joining method와 Kimura 2 parameter methods (1,000 bootstraps)에 의해 분석하였다.

결과 및 고찰

모자이크와 황화 증상을 보이는 속속이풀(Fig. 1A)의 바이러스 감염 여부를 조사하기 위해 가장 대표적인 6종의 국내 고추감염바이러스에 대한 검정 프라이머(Table 1)를 이용하여 RT-PCR 진단을 실시하였다. 6종 고추감염바이러스에 대한 각 진단 프라이머를 이용하여 검정한 결과, 채집한 속속이풀 시료가 PMMoV와 CMV에 복합 감염되어 있음을 확인할 수 있었다(Fig. 1B). 한편, 속속이풀 채집 지역 인근의 고추 농가의 바이러스 발생 현황(Table 3) 조사에서도 CMV와 PMMoV가 다수 발생되어 속속이풀이 고추의 바이러스 감염에 대한 중간 기주로서 작용될 수 있을 것으로 예상되었다. 고추 PMMoV와 CMV의 중간 기주로서의 속속이풀의 역할을 증명하기 위해 먼저 속속이풀에서 분리한 PMMoV와 CMV의 전체 염기서열을 분석하였다. PMMoV는 Tobamovirus에 속하는 positive sense single-stranded RNA 바이러스이며, CMV는 Cucumovirus의 대표 바이러스로서 3개의 positive sense single-stranded RNA로 구성된 바이러스이다. 따라서 각 바이러스의 게놈에 대한 5’ 말단과 3’ 말단 프라이머를 제작하여 각각의 RNA를 증폭하였다. CMV의 경우 RNA1과 2는 말단 염기서열이 매우 유사하여 동일 프라이머를 이용하여 전체 유전자 증폭에 이용하였다. 최종 RT-PCR 산물은 각 RNA의 특이 프라이머(Table 2)를 이용하여 1 kb 간격으로 양방향 프라이머에 의해 염기서열을 최종적으로 확인하였다. 각 바이러스 RNA의 5’과 3’ 말단 염기서열은 RACE-PCR을 이용하여 결정하였다. 이렇게 분석된 전체 염기서열 결과, 속속이풀에서 분리된 PMMoV (PMMoV-RP)는 6,357개의 염기로 결정되었으며, NCBI Genbank에 수탁번호 KR108206로 등록하였고, CMV (CMV-RPDJ)의 경우 RNA 1, 2, 3는 각각 3,362개, 3,024개, 2,211개의 염기로 구성되어 있음을 확인하고 각 RNA에 대해 수탁번호 KT310080, KT310081 및 KT310082로 등록하였다.
Table 3
Incidence of pepper viruses in the pepper fields near the site where the infected Rorippa palustris was collected in Dangjin area
  Field Examined sample No. samples infected with pepper viruses*

CMV BBWV2 PMMoV PVY PepMoV TSWV
Dangjin-1 12 10 12 8 3 0 0
Dangjin-2 15 13 15 10 5 0 0

CMV, Cucumber mosaic virus; BBWV2, Broad bean wilt virus 2; PMMoV, Pepper mild mottle virus; PVY, Potato virus Y; PepMoV, Pepper mottle virus; TSWV, Tomato spotted wilt virus.

* Virus detection was performed by RT-PCR.

전체 게놈 염기서열 결과를 바탕으로 국내외 보고된 PMMoV와 CMV의 다양한 분리주들과의 계통발생학적 유연관계를 분석하였다. NCBI GenBank에 전체염기서열이 등록된 PMMoV의 경우 대부분 고추에서 분리된 바이러스 염기서열이었다. 분리주들은 일본계통(TPO-2-19, Pa18, C1421, J, Iw, L4BV), 중국계통(CN), 브라질계통(BR-DF01), 인도계통(HP1), 스페인계통(S, Ia) 국내계통(Kr)의 총 12개 PMMoV를 수집하였고, outgroup인 TMV와 함께 계통분석을 실시하였다. PMMoV의 phylogenetic tree는 크게 2개의 cluster로 나뉘었으며 RP 분리주는 subgroup I에 포함되는 것으로 나타났다(Fig. 2). 염기서열 유사도 분석결과, PMMoV-RP 분리주는 12개의 PMMoV 분리주와 94.9% 이상의 상동성을 나타냈고 일본계통인 C1421, J 분리주와 99.7%로 가장 높은 유사도를 보였다. 또한 속속이풀 채집지역 주변의 고추에서 분리한 PMMoV (DJP1, DJP2)의 외피단백질 분석에서도 99%의 유사도를 나타내었다(data not shown). 이러한 유사성은 속속이풀이 PMMoV에 대한 바이러스 중간 기주로 작용하여 고추포장으로의 바이러스 전염을 매개할 수 있음을 시사한다.
Fig. 2
Neighbor-joining tree inferred from full genome sequences of 13 Pepper mild mottle virus isolates and Tobacco mosaic virus (TMV) as an outgroup. The numbers on the nodes represent the percentage of 1,000 bootstrap replications. GenBank accession numbers are given in parentheses. Full genome sequence of the isolate RP was newly determined in this study. TPO-2-19, Pa18, C1421, J, Iw, and L4BV isolated from pepper in Japan; S and Ia from pepper in Spain; Kr from pepper in Korea; CN from pepper in China; BR-DF01 from pepper in Brazil; HP1 from pepper in India.
RPD_22_025_fig_2.jpg
CMV의 경우, 기존에 보고된 13개의 CMV 분리주와 outgroup으로 PSV에 대해 유연관계를 분석하였다(Fig. 3). 최근 고추에서 분리되어 전체 염기서열이 결정된 45개의 CMV 분리주 중에서 각 지역에서 대표로 10개의 분리주(RP2, RP5, RP8, RP17, RP19, RP28, RP31, RP35, RP44, RP47; Kim 등, 2014)를 선발하였고 그 외 국내 분리주인 GTN (Choi 등, 2015)과 CMV subgroup I, II의 대표 분리주인 Fny와 Q stain (Rezaian 등, 1985; Rizzo와 Palukaitis, 1989)에 대하여 계통분석을 하였다. 3개의 RNA에 대한 CMV phylogenetic tree 결과 CMV-RPDJ는 Fny가 포함된 subgroup I에 속하는 것으로 나타났다(Fig. 3). RNA1의 경우 RPDJ 분리주와 가장 높은 상동성을 보이는 분리주는 RP28 (98.7%), RP47 (98.5%), RP2 (98.4%)였으며 subgroup I의 다른 분리주와도 89.7%-90.9%의 유사도를 나타냈다. RNA2의 RPDJ는 RP8, RP17, RP19, RP31, RP35, RP44, GTN 분리주와 같은 cluster에 속하였으며 유사도는 99.3% 이상으로 나타났다. RNA3의 경우도 RNA2와 유사한 결과를 보였는데 RP17, RP19, RP31, RP35, RP44, GTN 분리주와 cluster를 이루었으며, 이들 분리주와의 상동성은 99.5% 이상인 것으로 조사되었다. 아울러, 인근 고추포장에서 분리한 CMV의 외피단백질 분석 결과에서도 PMMoV 경우와 마찬가지로 99% 이상의 상동성을 나타내었다(data not shown). CMV 계통분석 결과, RPDJ의 RNA1은 지역적으로 의성(RP28)과 하동(RP47)과 같은 남동부 지역의 분리주와 가장 유사한 반면(Fig. 3A), RNA2와 3는 서산(RP44), 청양(RP17), 충주(RP35), 부안(RP19)과 같은 중서부 지역의 분리주와 유사도가 가장 높은 것으로 나타났다(Fig. 3B, Fig. 3C). CMV는 주로 유전자 재배열(genetic reassortment) 과정에 의해 진화 및 다양성을 가지는 바이러스로서 RPDJ 분리주의 경우 다른 지역의 국내 분리주 간의 유전자 재배열에 의해 발생한 분리주임을 고려해 볼 수 있다.
Fig. 3
Phylogenetic trees inferred from full genome sequences of 14 Cucumber mosaic virus (CMV) isolates and Peanut stunt virus (PSV) as an outgroup. The trees of CMV RNA1 (A), RNA2 (B), and RNA3 (C) were reconstructed by neighbor-joining method. The numbers on the nodes represent the percentage of 1,000 bootstrap replications. GenBank accession numbers are given in parentheses. Full genome sequence of the isolate RPDJ was newly determined in this study. RP2, RP5, RP8, RP17, RP19, RP28, RP31, RP35, RP44, RP47, and GTN isolated from pepper in Korea; Fny and Q isolated from USA.
RPD_22_025_fig_3.jpg
국내 고추포장에서 PMMoV와 CMV는 단독 또는 복합감염의 형태로 가장 피해가 큰 대표적인 바이러스이다. 특히 CMV의 경우 진딧물에 의한 매개전염을 하므로 속속이풀이 매개충의 서식장소로 작용할 경우 지속적인 바이러스병 발생의 전염원이 될 수 있다. 또한 PMMoV는 종자전염이 가능하므로 PMMoV에 감염된 속속이풀이 전염종자로 번식을 한다면 지속적인 바이러스 저장장소의 역할을 할 가능성이 있어 주의를 기울일 필요가 있다(Lewandowski, 1999). 결론적으로, 고추포장에서의 PMMoV와 CMV의 발생 방제를 위해서는 포장 주변의 속속이풀 및 다른 잡초 기주의 관리가 병행되어야 할 것으로 보인다.

Acknowledgement

This work was supported by a grant from the Basic Research Program (PJ010878012015) of National Institute of Horticultural and Herbal Science, Rural Development Administration, Republic of Korea.

References

Choi, G. S, Kwon, S. J, Choi, S. K, Cho, I. SYoon, J. Y Characteristics of Cucumber mosaic virus-GTN and resistance evaluation of chilli pepper cultivars to two Cucumber mosaic virus isolates. Res. Plant Dis. 2015. 21: 99-102.
Choi, J. K, Choi, G. S, Choi, J. K, Yu, B. JJeong, T. S Turnip mosaic virus isolated from Rorippa islandica Borb. Plant Pathol. J. 1994. 10: 136-139.
Coutts, B. A, Prince, R. TJones, R. A Quantifying effects of seedborne inoculum on virus spread, yield losses, and seed infection in the Pea seed-borne mosaic virus-field pea pathosystem. Phytopathology. 2009. 99: 1156-1167.
pmid
Edwardson, J. RChristie, R. G In: Edwardson J. R, Cucumoviruses. Viruses Infecting Forage Legumes. 1986. Gainesville, FL, USA: University of Florida.
Hobbs, H. A, Eastburn, D. M, D’Arcy, C. J, Kindhart, J. D, Masiunas, J. B, Voegtlin, D. J, Weinzierl, R. AMcCoppin, N. K Solanaceous weeds as possible sources of Cucumber mosaic virus in Southern Illinois for aphid transmission to pepper. Plant Dis. 2000. 84: 1221-1224.
pmid
Kim, J. S, Lee, S. H, Choi, H. S, Kim, M. K, Kwak, H. R, Nam, M, Kim, J. S, Choi, G. S, Cho, J. D, Cho, I. SChung, B. N Occurrence of virus disease on major crops in 2010. Res. Plant Dis. 2011 17: 334-341. (In Korean).
Kim, M. K, Seo, J. K, Kwak, H. R, Kim, J. S, Kim, K. H, Cha, B. JChoi, H. S Molecular genetic analysis of Cucumber mosaic virus populations infecting pepper suggests unique patterns of evolution in Korea. Phytopathology. 2014. 104: 993-1000.
pmid
Kwon, S. J, Choi, H. S, Han, J. H, La, Y. JKim, K. H Three different viruses isolated from typical weed plants that grown adjacent to commom crop fields. Plant Pathol. J. 2000. 16: 297-305.
Kwon, S. J, Tan, S. HVidalakis, G Complete nucleotide sequence and genome organization of an endornavirus from bottle gourd (Lagenaria siceraria) in California, U.S.A. Virus Genes. 2014. 49: 163-168.
pmid
Lewandowski, D. J In: Van Regenmortel M. H. V, Fauquet C. M, Bishop D. H. L, Castens E. B, Estes M. K, Lemon S. M, Maniloff J, Mayo M. A, McGeoch D, Pringle C. R, Wickner R. B, Genus tobamovirus. Virus Taxonomy: Seventh Report of the International Committee on Taxonomy of Viruses. 1999. San Diego, CA, USA: Academic Press; p. 889-894.
Lian, S, Lee, J. S, Cho, W. K, Yu, J, Kim, M. K, Choi, H. SKim, K. H Phylogenetic and recombination analysis of Tomato spotted wilt virus. PLoS One. 2013. 8: e63380
pmid pmc
Rezaian, M. A, Williams, R. HSymons, R. H Nucleotide sequence of cucumber mosaic virus RNA. 1. Presence of a sequence complementary to part of the viral satellite RNA and homologies with other viral RNAs. Eur. J. Biochem. 1985. 150: 331-339.
pmid
Rist, D. ELorbeer, J. W Relationships of weed reservoirs of cucumber mosaic virus (CMV) and broad bean wilt virus (BBWV) to CMV and BBWV in commercial lettuce fields in New York. Phytopathology. 1991. 81: 367-371.
Rizzo, T. MPalukaitis, P Nucleotide sequence and evolutionary relationships of Cucumber mosaic virus (CMV) strains: CMV RNA 1. J. Gen. Virol. 1989. 70: 1-11.
pmid


ABOUT
BROWSE ARTICLES
EDITORIAL POLICY
FOR CONTRIBUTORS
Editorial Office
Rm,904 (New Bldg.) The Korean Science & Technology Center 22, Teheran-ro 7-gil, Gangnam-gu, Seoul 06130, Korea
Tel: +82-2-557-9360    Fax: +82-2-557-9361    E-mail: paper@kspp.org                

Copyright © 2021 by The Korean Society of Plant Pathology.

Developed in M2PI

Close layer
prev next