Res. Plant Dis > Volume 21(2); 2015 > Article
국내 박과 작물에서 과실썩음병을 일으키는 Acidovorax citrulli 집단의 유전적 특성

요약

Acidovorax citrulli 전 세계적으로 다양한 박과 작물 재배포장에서 과실썩음병(bacterial fruit blotch)을 일으키며, 경제적으로 큰 피해를 주고 있다. 효과적인 병 방제 전략을 수립하기 위한 기초자료를 얻고자 전국의 주요 박과 작물 재배지역으로부터 얻은 A. citrulli 33균주들을 대상으로 5개 유전자(16S rRNA, adk, gltA, glyA, pilT)를 이용한 multi-locus 유연관계 분석을 실시하였다. 국내 A. citrulli 집단은 종 특이적이며, 그룹 특이적인 유전적 특성들을 기반으로 KCC1과 KCC2 그룹으로 나누어졌으며, 이들은 수박과 오이와 멜론분리균들을 모두 포함했고 이들 중 KCC2 그룹 균주들의 발생이 우세했다. KCC1 그룹 균주들은 수박이외 기주에서의 발생비율이 64%였으나, KCC2 그룹에서는 수박분리균의 비율이 72%로 우세하였다. 본 연구결과는 국내 A. citrulli 집단에 유전적인 변이가 존재한다는 것을 밝혔으며, 효과적인 박과 작물 과실썩음병 방제체계 수립에 있어서 매우 유용한 자료로 활용될 것으로 판단된다.

ABSTRACT

Acidovorax citrulli, the causal agent of bacterial fruit blotch, has caused an economically destructive damage in cucurbits cultivation fields worldwide. To consider more effective disease management, 33 A. citrulli isolates collected from various cucurbits in Korea were analysed by multi-locus phylogeny using five conserved loci (16S rRNA, adk, gltA, glyA, pilT). Two distinct groups (KCC1 and KCC2) in the population were identified on the base of group-specific genetic variation. Out of them, the predominant group was KCC2 and both groups included isolates from melon, cucumber and watermelon. Sixty-four percent of KCC1 isolates were recovered from non-watermelon hosts and seventy-two percent of KCC2 isolates from watermelon. This study presented that there was genetic differentiation among A. citrulli population in Korea. Also, these results will be applied as a very useful data in effective disease management.

서론

A. citrulli(=A. avenae subsp. citrulli)는 1980년대 미국의 수박 재배포장에서 그 발생이 최초로 보고된 이후 오늘날에 이르기까지 전 세계적으로 다양한 박과 작물에서 과실썩음병(bacterial fruit blotch, BFB)을 일으키며, 경제적으로 큰 피해를 주고 있는 것으로 알려져 있다(Assis 등, 1999; Burdman과 Walcott, 2012; Cheng 등, 2000; Gemir, 1996; Hopkins, 1989, 2003; Isakeit 등, 1997; Martin과 Horlock, 2002; Schaad 등, 2008; Shirakawa 등, 2000). 국내에서는 Song 등(1991)에 의해 전북 고창 수박 재배지역에서의 발생이 최초 보고된 이래 현재까지 전국의 주요 수박, 멜론재배지에서 지속적으로 병발생과 그 피해가 보고되고 있다(Seo 등, 2006).
A. citrulli는 주로 종자전염에 의해 1차적인 BFB를 발생시키는데, 극소수가 종자에 감염이 되었을 경우라도 밀식재배 상태의 육묘 상에서 일단 발병 시 단시간에 급속히 확산되며 유묘에 특별한 병징없이 잠재적인 감염상태로 재배포장에 이식되어 접목 및 관수 시 매우 폭발적인 전염을 일으켜 종자와 유묘 및 과실 생산에 큰 피해를 주고 있다(Dutta 등, 2012; Hopkins와 Thompson, 2002b; Rane과 Latin, 1992; Walcott 등, 2003). 하지만 다른 많은 세균성 병해처럼 적절한 화학적 방제수단이 없으며, 가장 효과적인 병관리 방법으로 알려진 병저항성 품종의 포장 적용도 지속적으로 수행되고 있지만 뚜렷한 효과를 나타내지 못하고 있어 병관리 대책 수립에 많은 어려움을 겪고 있다(Hopkins, 1991; Hopkins와 Thompson, 2002a; Walcott, 2008).
이 병원균 집단의 보다 효과적인 병관리 대책을 수립하기 위해 많은 연구자들이 세균학적, 병리학적 및 유전학적 특성 분석 에 관련된 연구들을 수행해 왔다. Schaad 등(2008)은 박과 작물의 식물병원균인 A. avenae subsp. citrulli에 대해 다른 Acidovorax 속 식물병원균들과는 다른 특성들을 확인하고 개별종인 A. citrulli로 부를 것을 제안했다. 또한 다른 많은 연구자들의 다양한 분석 결과들을 통해 A. citrulli 집단 내에 유전적 다양성이 존재함이 알려졌다(Burdman 등, 2005; Makizumi, 2011; Walcott 등, 2000; 2004). Walcott 등(2004)A. citrulli 집단 내에는 주로 수박 이외의 기주로부터 분리한 균주들로 구성된 그룹 I과 수박분리균이 대다수를 차지하는 그룹 II가 존재함을 보고했다. 한편, Feng 등(2009)은 multi-locus DNA 염기서열을 이용한 집단 내 유전적 다양성 분석을 통해 Walcott 등(2004)의 결과와 마찬가지로 A. citrulli 집단을 크게 CC1과 CC2 그룹으로 나누었다. 한편, 이들 연구결과들로부터 수박과 멜론으로부터 분리된 다수의 미국과 중국에서 수집된 A. citrulli 균주들은 유전적으로 특성이 다른 각 그룹별로 나뉘어지며, 병원균 집단 내 분리기주와 연관된 유전적 다양성이 존재함이 확인되었으나 분석대상에 포함된 한국 수박분리균은 단지 한 균주로 전 세계적으로 분리빈도가 가장 높은 CC2 그룹에 포함된다는 점만을 확인할 수 있었을 뿐이었다. 또한 현재까지 국내 A. citrulli 집단과 관련된 연구는 주로 수박, 멜론, 오이 등에서의 최초 발생이 보고된 상태이며 유전적 다양성에 관련된 연구는 전무한 실정이다. 따라서 본 연구에서는 박과 작물에서 과실썩음병을 일으키는 국내 A. citrulli 집단에 대한 효율적인 방제 전략을 수립하는 데 기초 자료로 활용하고자 multi-locus DNA 염기서열을 이용한 분리기주 별 종내 유전적 다양성 분석을 수행하였다.

재료 및 방법

사용균주 및 DNA 분리

2011년부터 2014년까지 전국의 주요 박과 작물인 오이, 수박, 멜론 재배지역의 병든 식물체들로부터 수집하여 분리한 A. citrulli 33균주(Table 1) 및 박과 작물에서 유사병징을 나타낸 3종의 Acidovorax spp.를 nutrient agar 또는 King’s B 배지에 배양하여 글리세롤에 현탁한 후 -70°C로 유지된 초저온고에 보관하며 사용하였다. 유전적 다양성 분석을 위한 공시균주로 사용하기 위해서 접종원 농도(106-107 cfu/ml)를 조절하여 수박 유묘에 인공접종 후 병원성을 확인하였으며, 공시균주의 DNA는 DNeasy Tissue Kit(Quigen)을 이용하여 추출했다.
Table 1
Acidivorax citrulli isolates isolated from cucurbit cultivation fields in Korea
Strain Species Year Host Geographic origin Group
11246 A. citrulli 2012 melon Gokseong, Jeonnam KCC1
11247 A. citrulli 2012 melon Gokseong, Jeonnam KCC1
11248 A. citrulli 2012 melon Gokseong, Jeonnam KCC1
12091 A. citrulli 2012 watermelon Buyeo, Chungnam KCC1
12158 A. citrulli 2012 watermelon Nonsan, Chungnam KCC1
14194 A. citrulli 2014 melon Anseong, Gyeonggi KCC1
14201 A. citrulli 2014 melon Gwangju City KCC1
14202 A. citrulli 2014 melon Anseong, Gyeonggi KCC1
14222 A. citrulli 2014 watermelon Icheon, Gyeonggi KCC1
17001 A. citrulli 2012 watermelon Nonsan, Chungnam KCC1
17002 A. citrulli 2012 cucumber Anseong, Gyeonggi KCC1
11073 A. citrulli 2011 watermelon Yeongam, Jeonnam KCC2
11147 A. citrulli 2011 watermelon Gochang, Jeonbuk KCC2
11162 A. citrulli 2011 watermelon Buyeo, Chungnam KCC2
11163 A. citrulli 2011 watermelon Buyeo, Chungnam KCC2
11164 A. citrulli 2011 watermelon Nonsan, Chungnam KCC2
11165 A. citrulli 2011 watermelon Nonsan, Chungnam KCC2
11171 A. citrulli 2011 cucumber Nonsan, Chungnam KCC2
11201 A. citrulli 2012 watermelon Jinju, Gyeongnam KCC2
11251 A. citrulli 2012 watermelon Suwon, Gyeonggi KCC2
11259 A. citrulli 2012 watermelon Hamyang, Gyeongnam KCC2
12089 A. citrulli 2012 watermelon Buyeo, Chungnam KCC2
12090 A. citrulli 2012 watermelon Buyeo, Chungnam KCC2
12170 A. citrulli 2012 cucumber Nonsan, Chungnam KCC2
13034 A. citrulli 2013 watermelon Anseong, Gyeonggi KCC2
13211 A. citrulli 2013 watermelon Youngam, Jeonnam KCC2
13217 A. citrulli 2013 cucumber Buyeo, Chungnam KCC2
13255 A. citrulli 2013 cucumber Yeongam, Jeonnam KCC2
14236 A. citrulli 2014 melon Gokseong, Jeonnam KCC2
17000 A. citrulli 2012 watermelon Buyeo, Chungnam KCC2
17005 A. citrulli 2012 watermelon Suwon, Gyeonggi KCC2
17912 A. citrulli 2012 watermelon Andong, Gyeongbuk KCC2
17913 A. citrulli 2012 pumpkin seed Busan City KCC2

PCR 증폭

16S rRNA(1,314 bp) 유전자의 증폭은 primer 27F와 1525R를 사용하였으며(Weisburg 등, 1991) gltA(487 bp)와 pilT(405 bp) 그리고 adk(437 bp)와 glyA(563 bp)의 유전자 증폭을 위해 기존에 보고(Feng 등, 2009; Yan 등, 2013)된 primer set을 활용하여 개별적인 유전자의 염기서열은 물론 총 3,206 bp 길이의 DNA 염기서열을 분석하였다(Table 2). 각각의 유전자 영역의 DNA 염기서열을 얻기 위해 primer 0.5 pmol, 2 ng의 genomic DNA, 0.2 mM dNTP, 10 mM Tris-HCl, 50 mM KCL, 1.5 mM MgCl2, 2.5 unit의 Taq DNA polymerase에 멸균수를 첨가하고 최종 volume을 50 µl로 맞춘 후 PCR을 수행했다. 16S rRNA의 PCR 반응 조건으로 denaturation은 95°C에서 5분 간 반응 후 cycle에서 94°C 30초, annealing은 55°C에서 30초, 합성은 72°C에서 90초로 총 35회 반복하였으며 최종 DNA 합성은 72°C에서 5분을 수행하였다. 그 이외에 다른 유전자들의 PCR 반응 조건은 annealing 조건만 60°C, 30초로 변경되어 사용됐다. 모든 PCR 산물은 1.5% agarose gel에서 전기영동하고, ethidium bromide로 염색하여 증폭 여부와 그 크기를 관찰하였다.
Table 2
PCR primers and lengths sequenced for the five genes used in this study
Gene Gene function Primer sequence (forward/reverse) Amplification length (bp)
16S rRNA 16S ribosomal RNA 27F: AGAGTTTGATCMTGGCTCAG 1,314
1525R: AAGGAGGTGWTCCARCC
adk Adenylate kinase adk1: GTTGGCCGGATCGTTCT 437
adk2: TCCGCAGATCTCCACCG
gltA Type II citrate synthase gltA1: GAAGTCCACGTTCGGGTAGA 487
gltA2: TACATGTACCCGCAGAACCA
glyA Serine hydroxymethyl transferase glyA1: AACAAGCCGATCCCGAAGT 563
glyA2: GGCGATGTCCACCCAGAAG
pilT Twitching motility protein pilT1: GAGTACATCTGCGCCACCTT 405
pilT2: GAATACGGGCACATCCTGAC

유연관계 분석

증폭된 PCR 산물은 솔젠트사의 PCR Purification Kit으로 정제하고, (주)제노텍에 sequencing 을 의뢰한 후 NCBI(National Center for Biotechnology Information)의 BLAST(Basic Local Alignment Search Tool)를 이용하여 DNA 데이터베이스와 유사한 염기서열을 비교하였다(http://blast.ncbi.nlm.nih.gov). 또한 16S rRNA, gltA, pilT 유전자의 염기서열을 이용한 multi-locus 유연관계 분석을 위해 대조로 GU339088, EU928011, EU928422(A. citrulli group I, ATCC 29625), NR_074638, CP000512:2419717-2420205, CP000512:2419717-2420205(A. citrulli group II, AAC00-1), AF137505, CP000512: 3327422-3327910, CP000512:645826-646230 (AF137505 A. avenae subsp. avenae, ATCC 19860), AF078765, EU928010, EU928421(A. facilis ATCC 11228), AF078760, EU928012, EU928423(A. konjaci ATCC 33996) 등의 기존에 밝혀진 Acidovorax spp.의 DNA 염기서열들을 NCBI site로 부터 얻어 활용하였다. 염기서열은 MEGA5를 이용하여 정렬하였고, 1,000회의 bootstrap 분석을 통해 신뢰도를 평가하였으며, 불분명하게 정렬된 부분은 분석에서 제외하였다.

염기서열 accession 번호

각 그룹을 대표하는 A. citrulli 11248, 12158, 14202(KCC1)와 13034, 13255, 17913, 11248(KCC2) 균주들의 glyA, adk, pilT, gltA, 16S rRNA 유전자 별로 염기서열들에 대해 각각 순차적으로 부여된 GenBank accession 번호는 KP776416부터 KP776450까지이다. KCC1과 KCC2 균주들은 모두 그룹내 균주들 간에 모든 유전자의 염기서열들이 모두 동일하였으므로 위에 열거한 각 그룹을 대표하는 이들 균주들을 선발하여 GenBank에 등록하였다.

결과 및 고찰

전국의 주요 박과 작물 재배지역으로부터 분리된 A. citrulli 33 균주 및 유사병징의 식물체로부터 수집된 Acidovorax 속 3종들에 대한 종동정을 위하여 16S rRNA(1,314 bp)에 대한 염기서열 분석을 실시한 결과 수박과 멜론 그리고 오이와 호박으로부터 각각 분리된 11균주들은 기존에 보고된 ATCC 29625(A. citrulli group I, GU339088)와 22균주들은 AAC00-1(A. citrulli group II, NR_074638)와 각각 100% 일치해 A. citrulli로 동정할 수 있었다(Table 1). 또한 오이, 수박, 멜론으로부터 A. avenae 1균주, A. konjaci 2균주 그리고 A. valerianella 8균주들이 동정되었는데, A. valerianella의 경우는 수박, 멜론, 오이 등에서 폭넓게 분리되어 동일 기주에서 유사병징을 나타내며 병을 발생시키는 것을 확인할 수 있었다(data not shown). Schaad 등(2008)은 박과 작물의 식물병원균인 A. avenae subsp. citrulli에 대해 병원성, 지방산 분석, 기타 표현형 특성, 16S rDNA 염기서열 GC 함량값, 그리고 amplified fragment length polymorphism(AFLP) 등의 분석을 통해 다른 Acidovorax속 식물병원균들과는 다른 독특한 특성들을 확인하고 개별종인 A. citrulli로 부를 것을 제안했다. 한편, 일부 연구자들에 의한 GC-FAME(gas chromatography fatty acid methyl ester) 특성, 탄소원 기질 이용 양상, 분리기주별 병원성 특성, 동제 민감도 그리고 제한효소 SpeI로 처리된 DNA fragments의 PFGE(pulsed field gel electrophoresis)와 repetitive extragenic pallindromic(REP)-polymerase chain reaction(PCR) 등의 분석 결과를 통해 A. citrulli 집단내의 유전적 다양성 및 특징적인 그룹들의 존재가 알려졌다(Burdman 등, 2005; Makizumi, 2011; Walcott 등, 2000; 2004).
국내에서 발생하는 A. citrulli 집단에 대해 16S rRNA를 포함한 gltApilT 유전자의 염기서열들을 종합하여 multi-locus 유연관계 분석을 수행한 결과 이들은 모두 유전적으로 가장 유사한 A. avenae subsp. avenaeA. facilis 그리고 A. konjaci 등과는 별도로 단일 clade 내에 두 그룹(KCC1과 KCC2)으로 구분되었지만 모두 유전적으로 매우 가까운 동일 종임을 확인할 수 있었으며(Fig. 1), 유전적으로 가장 유사한 유사종인 대조균주들을 달리하여 adkglyA 유전자들에 대한 유연관계 분석에 있어서도 동일한 결과를 확인할 수 있었다(data not shown). 또한, adkglyA 유전자를 포함한 5개 유전자의 DNA 염기서열 변이분석에 있어서 KCC1과 KCC2 그룹 균주들 간에 종 특이적이며 그룹특이적인 염기변이가 확인되었는데, 439, 442, 451번째 위치에서 염기변이가 나타난 gltA를 제외한 나머지 4개 유전자들에서는 각각 다른 위치에서 단일 염기의 변이가 존재했다(Table 3).
Table 3
Comparison of DNA variation sites within five genes of Acidovorax citrulli KCC1 and KCC2 group
Group Gene

16S (140)1 gltA (439, 442, 451) glyA (452) pilT (94) adk (30)
KCC1 T2 C,G,A A C C
KCC2 C G,A,C G T T

1 DNA variation site within each gene.

2 A, adenine; C, cytocine; G, guanine; T, thymine.

Fig. 1
Maximum likelihood phylogeny of 33 Korean isolates of Acidovorax citrulli, 2 strains of A. citrulli group I and II (Feng et al., 2009; Walcott et al., 2004) and 3 Acidovorax spp. as the outgroup. The tree was constructed from 2,208 bp from three genes: 16S rRNA; pilT, twitching motility protein and gltA, type II citrate synthase. Bootstrap values with 1,000 replicates for the major divisions of A. citrulli from the outgroups.
RPD_21_082_fig_1.jpg
Feng 등(2009)은 전 세계적으로 발생하고 있는 A. citrulli 집단에 대해 multi-locus를 통한 유전적 다양성 분석에 있어서 다른 유전자들은 균주들 간에 2개 이하의 염기서열의 변이를 확인하였으며, gltA의 경우는 비록 소수지만 균주들 간에 조금 더 많은 7개 이하의 변이도 존재하고 있음을 보고했다. 비록 국내 박과작물에서 발생하는 A. citrulli 집단이 다른 나라 연구자들의 결과와 유사하게 그룹 특이적인 유전적 특성에 따라 두 그룹으로 나누어지지만, 그룹 내 또는 그룹 간의 유전적 변이는 비교적 낮은 편이다. 이는 제한된 국내 발생지역과 그리고 재배품종의 다양성과 관련된 것으로 판단되는데 추후 다양한 박과 작물들에 있어서 좀 더 많은 품종들이 재배된다면 국내 병원균 집단의 유전적 다양성도 증가할 것으로 판단된다.
Walcott 등(2004)은 이 병원균 집단 내에는 수박 이외의 기주로부터 분리한 균주들이 대부분으로 동제에 비교적 덜 민감한 그룹 I과 주로 수박분리균들로 구성되어 있으며 동제에 민감하고 그룹 I 보다 수박에 더 강한 병원성을 나타내는 그룹 II가 존재함을 보고했다. 한편, Feng 등(2009)은 multi-locus DNA 염기서열을 이용한 집단 내 유전적 다양성 분석을 통해 Walcott 등 (2004)의 결과와 마찬가지로 A. citrulli 집단을 크게 CC1과 CC2 그룹으로 나누었다. 또한 이들의 연구를 통해 전 세계적으로 가장 오래 보관되어온 것으로 알려진 1978년 미국에서 발생한 수박균주들은 모두 CC1 그룹에 속하였으며, 중국에서 발생률이 높았던 CC1 그룹 균주들이 멜론과 수박으로부터 비슷한 비율로 발생되었고, CC2 그룹에는 주로 전 세계적으로 폭넓게 수집된 수박분리균들로 구성되었음을 알 수 있었다. Yan 등(2013)은 2000년부터 2010년 동안 7개 지역의 중국에서 발생한 A. citrulli 집단에는 타연구 결과들과 유사하게 수박보다 멜론에서의 발생비율이 상대적으로 높은 그룹 1과 주로 수박으로부터 분리된 균주들로 구성된 그룹 2, 그리고 한 균주이지만 유전적으로 크게 구별되는 그룹 3이 존재함을 보고했다.
본 연구에서 조사된 총 33개 중 11개를 차지하는 KCC1 그룹 균주들은 이미 알려진 그룹 I 또는 CC1 그룹의 대표균주인 A. citrulli ATCC 29625(Feng 등, 2009; Walcott 등, 2004)와 16S rRNA, gltA, pilT 등의 유전자 염기서열들을 비교한 결과 모두 100% 일치했다. 또한 KCC1 그룹 균주들 간의 gltA, glyA 염기서열 비교에서도 그룹 특이적으로 모두 100% 동일하였으며, KCC2 그룹과는 달리 타연구자들의 결과와 유사하게 멜론에서의 분리비율이 더 높았다(Table 4). 한편, 수박분리균의 발생비율이 72%로 매우 우세한 KCC2 그룹 균주들은 전 세계적으로 폭넓게 발생하는 것으로 알려진 그룹 II 또는 CC2 그룹의 대표균주인 A. citrulli AAC00-1 균주(Walcott 등, 2004)와 유전자 염기서열들이 모두 100% 일치했다. 또한, KCC1 그룹보다 A. citrulli 집단내 발생비율도 63%로 높았으며, 경기, 경북, 전남, 전북, 충남 등지의 좀 더 넓은 박과 작물 재배지역에서 발생했다. 하지만 국내에서 발생하는 A. citrulli 두 그룹 모두 수박, 멜론, 오이 등에서 발생이 확인되어 분리기주에 따른 발생 특이성은 보이지 않았다. 따라서 전국의 주요 박과 작물 재배지역으로부터 얻어진 A. citrulli 집단에 대한 5개 유전자 총 3,206 bp 길이의 DNA 염기서열을 분석한 결과 유전자 염기서열의 변이 특성에 따라 크게 KCC1과 KCC2 그룹으로 나뉘어졌으며, 각기 그룹 균주들은 특정 기주에서만 발견되지 않고 기주 별로 발생빈도에 따른 차이를 나타냈다. 특히 KCC1 그룹 균주들은 수박에서보다 멜론에서의 발생 비율이 약간 높았지만, KCC2 그룹 균주들은 타기주에서 보다 수박에서의 발생률이 월등히 높았고 전국적으로 좀 더 넓은 발생분포를 나타냈다.
Table 4
Korean Acidovorax citrulli isolates according to host plants and groups used in this study
Host / Group KCC1 KCC2 Total
Watermelon 4 16 20
Melon 6 1 7
Cucumber 1 4 5
Pumpkin 0 1 1

Total 11 22 33
본 연구결과는 국내 A. citrulli 집단의 유전적 다양성에 관련된 최초 보고로 의미가 크지만 추후 이들 그룹 균주들 간의 다양한 기주들에 대한 병원성 차이 및 다양한 약제반응에 대한 특성 비교 분석이 수행된다면 효과적인 병 방제 체계 수립에 있어서 매우 유용한 자료로 활용될 것으로 판단된다.

Acknowledgement

This research was supported by Golden Seed Project (Project No. 213002042SBS10), Ministry of Agriculture, Food and Rural Affairs, Korea.

References

Assis, S. M. P, Mariano, R. L. R, Silva-Hanlin, D. M. W and Duarte, V Bacterial fruit blotch caused by Acidovorax avenae subsp. citrulli in melon, in the state of Rio Grande Do Norte, Brazil. Fitopatol. Bras. 1999. 24: 191.
Burdman, S, Kots, N, Kritzman, G and Kopelowitz, J Molecular, physiological, and host-range characterization of Acidovorax avenae subsp. citrulli isolates from watermelon and melon in Israel. Plant Dis. 2005. 89: 1339-1347.
pmid
Burdman, S and Walcott, R. R Acidovorax citrulli: generating basic and applied knowledge to tackle a global threat to the cucurbit industry. Mol. Plant Pathol. 2012. 13: 805-815.
pmid pmc
Cheng, A. H, Hsu, Y. L, Huang, T. C and Wang, H. L Susceptibility of cucurbits to Acidovorax avenae subsp. citrulli and control of fruit blotch on melon. Plant Pathol. Bull. 2000. 9: 151-156.
Dutta, B, Scherm, H, Gitaitis, R. D and Walcott, R. R Acidovorax citrulli seed inoculum load affects seedling transmission and spread of bacterial fruit blotch of watermelon under greenhouse conditions. Plant Dis. 2012. 96: 705-711.
pmid
Feng, J. J, Schuenzel, E. L, Li, J and Schaad, N. W Multilocus sequence typing reveals two evolutionary lineages of Acidovorax avenae subsp. citrulli. Phytopathology. 2009. 99: 913-920.
pmid
Gemir, G A new bacterial disease of watermelon in Turkey: bacterial fruit blotch of watermelon [Acidovorax avene subsp. citrulli (Schaad et al.) Willems et al.]. J. Turk. Phytopathol. 1996. 25: 43-49.
Hopkins, D. L Control of bacterial fruit blotch of watermelon with cupric hydroxide. Phytopathology. 1991. 81: 1228.
Hopkins, D. L Bacterial fruit blotch of watermelon: a new disease in the eastern USA. Proc. Cucurbitaceae. 1989. 89: 74-75.
Hopkins, D. L and Thompson, C. M Evaluation of Citrullus sp. germplasm for resistance to Acidovorax avenae subsp. citrulli. Plant Dis. 2002a. 86: 61-64.
Hopkins, D. L and Thompson, C. M Seed transmission of Acidovorax avenae subsp. citrulli in cucurbits. Hortscience. 2002b. 37: 924-926.
Isakeit, T, Black, M. C, Barnes, L. W and Jones, J. B First report of infection of honeydew with Acidovorax avenae subsp. citrulli. Plant Dis. 1997. 81: 694
Martin, H. L and Horloc, C. M First report of Acidovorax avenae subsp. citrulli as a pathogen of Gramma in Australia. Plant Dis. 2002. 86: 1406
Makizumi, Y, Igarashi, M, Gotoh, K, Murao, K, Yamamoto, M, Udonsri, N, Ochiai, H, Thummabenjapone, P and Kaku, H Genetic diversity and pathogenicity of cucurbit-associated Acidovorax. J. Gen. Plant Pathol. 2011. 77: 24-32.
crossref
Rane, K. K and Latin, R. X Bacterial fruit blotch of watermelon: Association of the pathogen with seed. Plant Dis. 1992. 76: 509-512.
crossref
Schaad, N. W, Postnikova, E and Randhawa, P eds. by N. S. Lacobellis, Emergence of Acidovorax avenae subsp. citrulli as a crop threatening disease of watermelon and melon. In: Pseudomonas syringae and Related Pathogens, 2003. Dordrecht, The Netherlands. Kluwer Academic Publishers, pp. 573-581.
Schaad, N. W, Postnikova, E, Sechler, A, Claflin, L. E, Vidaver, A. K, Jones, J. B, Agarkova, I, Ignatov, A, Dickstein, E and Ramundo, B. A Reclassification of subspecies of Acidovorax avenae as A. avenae (Manns 1905) emend A. cattleyae (Pavarino 1911) comb. nov A. citrulli (Schaad et al 1978) comb. nov., and proposal of A. oryzae sp. nov. Syst. Appl. Microbiol. 2008. 31: 434-446.
pmid
Seo, S. T, Park, J. H, Lee, J. S, Han, K. S and Cheong, S. R Bacterial fruit blotch of melon caused by Acidovorax avenae subsp. citrulli. Res. Plant Dis. 2006 12: 185-188. In Korean.
Song, W. Y, Kim, H. M, So, I. Y and Kang, Y. K Pseudomonas pseudoalcaligenes subsp citrulli: The causal agent of bacterial fruit blotch rot on watermelon. Korean J. Plant Pathol. 1991 7: 177-182. In Korean.
Shirakawa, T, Kikuchi, S, Kato, T, Abiko, A and Kaiwa, A Occurrence of watermelon bacterial fruit blotch in Japan. Jpn. J. Plant Pathol. 2000. 66: 223-231.
Walcott, R. R, Langston, D. B, Sanders, F. H and Gitaitis, R. D Investigating intraspecific variation of Acidovorax avenae subsp. citrulli using DNA fingerprinting and whole cell fatty acid analysis. Phytopathology. 2000. 90: 191-196.
pmid
Walcott, R. R, Gitaitis, R. D and Castro, A. C Role of blossoms in watermelon seed infestation by Acidovorax avenae subsp. citrulli. Phytopathology. 2003. 93: 528-534.
pmid
Walcott, R. R, Fessehaie, A and Castro, A. C Differences in pathogenicity between two genetically distinct groups of Acidovorax avenae subsp. citrulli on cucurbit hosts. J. Phytopathol. 2004. 152: 277-285.
Walcott, R. R eds. by A Ciancio and K. G Mukerji, Integrated pest management of bacterial fruit blotch of cucurbits. In: Integrated Management of Diseases Caused by Fungi, Phytoplasma and Bacteria, 2008. Netherlands. Springer, pp. 191-209.
crossref
Wechter, W. P, Levi, A, Ling, K.-S, Kousik, C and Block, C. C Identification of resistance to Acidovorax avenae subsp. citrulli among melon (Cucumis spp.) plant introductions. HortScience. 2011. 46: 207-212.
Yan, S, Yang, Y, Wang, T, Zhao, T and Schaad, N. W Genetic diversity analysis of Acidovorax citrulli in China. Eur. J. Plant Pathol. 2013. 136: 171-181.


ABOUT
BROWSE ARTICLES
EDITORIAL POLICY
FOR CONTRIBUTORS
Editorial Office
Rm,904 (New Bldg.) The Korean Science & Technology Center 22, Teheran-ro 7-gil, Gangnam-gu, Seoul 06130, Korea
Tel: +82-2-557-9360    Fax: +82-2-557-9361    E-mail: paper@kspp.org                

Copyright © 2022 by The Korean Society of Plant Pathology.

Developed in M2PI

Close layer
prev next